View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21538_high_22 (Length: 263)
Name: NF21538_high_22
Description: NF21538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21538_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 17363778 - 17363976
Alignment:
| Q |
1 |
acacaagtgttttctttctatttggtatttatgggtttccaaggaaaatggctttctgtaagtgttcttgttctcttcattgtttttgatcttagcatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17363778 |
acacaagtgttttctttctatttggcatttatgggtttccaaggaaaatggctttctgtgagtgttcttgttctcttcattgttcttgatcttagcatgt |
17363877 |
T |
|
| Q |
101 |
ttgctcttggtgatcacaagcttga-ccaagaaaggtttggagatgatgattgccgatttagacgtggacctcgctgtagaggttggggtggtcgccgc |
198 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17363878 |
ttgctcttggtgatcacaagcttgacccaagaaaggtttggggatgatgattgtcgatttagacgtggacctcgctgtagaggttggggtggtcgccgc |
17363976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 17368250 - 17368447
Alignment:
| Q |
1 |
acacaagtgttttctttctatttggtatttatgggtttccaaggaaaatggctttctgtaagtgttcttgttctcttcattgtttttgatcttagcatgt |
100 |
Q |
| |
|
||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17368250 |
acacaagtgatttatttctatttggcatttatgggtttccaaggaaaatggctttctgtgagtgttcttgttctcttcattgttcttgatcttagcatgt |
17368349 |
T |
|
| Q |
101 |
ttgctcttggtgatcacaagcttgaccaagaaaggtttggagatgatgattgccgatttagacgtggacctcgctgtagaggttggggtggtcgccgc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17368350 |
ttgctcttggtgatcacaagcttgaccaagaaaggtatggagatgattattgccgatatagacgtggacctcgctgtagaggttggggtggtcgccgc |
17368447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University