View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21538_low_20 (Length: 292)
Name: NF21538_low_20
Description: NF21538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21538_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 32641416 - 32641692
Alignment:
| Q |
1 |
gattggtgaaaccatttactatatcatatcatagataaaaataatatttgttaagattatagtaattaagattaccttttgaccctcttgggatccacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32641416 |
gattggtgaaaccatttactatatcatatcatagataaaaataatatttgttaagattata---attaagattaccttttgaccctcttgggatccacaa |
32641512 |
T |
|
| Q |
101 |
cggtttcagtgcaggtgatgtttccggaggaagatggcgccgccgccgcctcatttttacatgaaccgtcgtcatcaacggcttcatccttaggcttcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32641513 |
cggtttcagtgcaggtgatgtttccggaggaagatggcgccgccgccgcctcatttttacatgaaccgtcgtcatcaacggcttcatccttaggcttcac |
32641612 |
T |
|
| Q |
201 |
ctcatgatgaagataatgctcttgaggttgtgcatccaacaccattgccattggtttctcttcattgttattgctatttt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32641613 |
ctcatgatgaagataatgctcttgaggttgttcatccaacaccattgccattggtttctcttcattgttattgctatttt |
32641692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University