View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21538_low_24 (Length: 255)
Name: NF21538_low_24
Description: NF21538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21538_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 32098531 - 32098769
Alignment:
| Q |
1 |
ttggtgcttcatacattaagagacttaaacagtcttaacatcaacatacccttgcaattaagtgatcaacgtatcaaacatgtttatcatttctaaagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32098531 |
ttggtgcttcatacattaagagacttaaacagtcttaacatcaacatacccttacaattaagtgatcaacgtatcaaccatgtttatcatttctaaagac |
32098630 |
T |
 |
| Q |
101 |
caaactcgtgcaaacatgatggaataacaaaacatagaaacccgaaagtttcttaccaaagtatcaatctcaccatgtccctgctcttaggccatgaaac |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32098631 |
caaactcttgcaaacatgatggaataacaaaacatagaaacccgaaagtttcttaccaaagtatcaatctcaccatgtccctgctcttaggccatgaaac |
32098730 |
T |
 |
| Q |
201 |
tggaactttataccctttgggaagaggcaacaaacaatg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32098731 |
cggaactttataccctttgggaagaggcaacaaacaatg |
32098769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 35879055 - 35878970
Alignment:
| Q |
151 |
tcttaccaaagtatcaatctcaccatgtccctgctcttaggccatgaaactggaactttataccctttgggaagaggcaacaaaca |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35879055 |
tcttaccaaagaatcaatctcaccatgtccctactcttaggccaatgaactggaactttataccctttaggaagaggcaacaaaca |
35878970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University