View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21539_high_18 (Length: 223)

Name: NF21539_high_18
Description: NF21539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21539_high_18
NF21539_high_18
[»] chr6 (2 HSPs)
chr6 (6-203)||(28048467-28048664)
chr6 (155-194)||(28037332-28037371)


Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 6 - 203
Target Start/End: Complemental strand, 28048664 - 28048467
Alignment:
6 gatgtcgaagaatattgaaggagaatatcgaaatccctgatttattataattttgcatgcaacttatagattatagatgaaagaaagtcataaaaatata 105  Q
    ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28048664 gatgtagaaaaatattgaaggagaatatcgaaatccctgatttattataattttgcatgcaacttatagattatagatgaaagaaagtcataaaaatata 28048565  T
106 taaaagtacaatgttgaagacatgagaatgttcggatggtttatggtggtgactaacttttagagataaattgaaaagagctttagacatgtcataag 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28048564 taaaagtacaatgttgaagacatgagaatgttcggatggtttatggtggtgactaacttttagagataaattgaaaagagctttagacatgtcataag 28048467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 194
Target Start/End: Complemental strand, 28037371 - 28037332
Alignment:
155 tgactaacttttagagataaattgaaaagagctttagaca 194  Q
    ||||||||||||||||||||||| |||| |||||||||||    
28037371 tgactaacttttagagataaattaaaaacagctttagaca 28037332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University