View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21539_high_18 (Length: 223)
Name: NF21539_high_18
Description: NF21539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21539_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 6 - 203
Target Start/End: Complemental strand, 28048664 - 28048467
Alignment:
| Q |
6 |
gatgtcgaagaatattgaaggagaatatcgaaatccctgatttattataattttgcatgcaacttatagattatagatgaaagaaagtcataaaaatata |
105 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28048664 |
gatgtagaaaaatattgaaggagaatatcgaaatccctgatttattataattttgcatgcaacttatagattatagatgaaagaaagtcataaaaatata |
28048565 |
T |
 |
| Q |
106 |
taaaagtacaatgttgaagacatgagaatgttcggatggtttatggtggtgactaacttttagagataaattgaaaagagctttagacatgtcataag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28048564 |
taaaagtacaatgttgaagacatgagaatgttcggatggtttatggtggtgactaacttttagagataaattgaaaagagctttagacatgtcataag |
28048467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 194
Target Start/End: Complemental strand, 28037371 - 28037332
Alignment:
| Q |
155 |
tgactaacttttagagataaattgaaaagagctttagaca |
194 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
28037371 |
tgactaacttttagagataaattaaaaacagctttagaca |
28037332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University