View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21539_low_12 (Length: 277)

Name: NF21539_low_12
Description: NF21539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21539_low_12
NF21539_low_12
[»] chr5 (1 HSPs)
chr5 (15-258)||(1077655-1077898)


Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 258
Target Start/End: Complemental strand, 1077898 - 1077655
Alignment:
15 gatagtggtagggaaaggacaaaataaataacaggtctaatcaaatcagtgggaatatattttgtggaggatgaaataaatgcatgataaaagcaacatg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1077898 gatagtggtagggaaaggacaaaataaataacaggtctaatcaaatcagtgggaatatattttgtggaggatgaaataaatgcatgataaaagcaacatg 1077799  T
115 gttaaattgaaagaagtaggattaaagcacacaaatgggcatgcatggccaattaattagaaccccatttgccttgtgaagttttcaaagatatgagtaa 214  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1077798 gttgaattgaaagaagtaggattaaagcacacaaatgggcatgcatggccaattaattagaaccccatttgccttgtgaagttttcaaagatatgagtaa 1077699  T
215 tgagtagactttcatgtttgtgaccgaataatattagaataaca 258  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
1077698 tgagtagactttcatgtttgtgaccgaataatattagaataaca 1077655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University