View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21539_low_13 (Length: 256)
Name: NF21539_low_13
Description: NF21539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21539_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 26501630 - 26501852
Alignment:
| Q |
18 |
ttgctctcatacgagcctcaactctttctaatccacacaagtcatcaatcatccagaatttcaatacattgggtgtcaacatagttttggtatgttatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26501630 |
ttgctctcatacgagcctcaactctttctaatccacacaagtcatcaatcatccagtatttcaatgcattgggtgtcaacatagttttggtatgt----a |
26501725 |
T |
|
| Q |
118 |
tatgttaatgaatctaatcaagtttaatgtctagcttaagctttaatattattaacagtactttcatgactttgttgatgcaatgagatatcatattaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26501726 |
tatgttaatgaatctaatcaagtttaatgtctagcttaagctttaata-tattaacagtactttcatgactttgttgatgcaatgagatatcatattaag |
26501824 |
T |
|
| Q |
218 |
aaatgtgatgagtacaacctgagttcat |
245 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
26501825 |
aaatgtgatgagtacaaccggagttcat |
26501852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University