View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21539_low_6 (Length: 441)
Name: NF21539_low_6
Description: NF21539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21539_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 184 - 411
Target Start/End: Complemental strand, 27819816 - 27819589
Alignment:
| Q |
184 |
agtaaccatgcatttcaccatcaatagatatatagatagagttgctaatttgaaaatggcttcaatccaactgcagaacactagattgaacctaaatcct |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27819816 |
agtaaccatgcatttcaccatcaatagatatatagatagagttgctaatttgaaaatggcttcaatccaactgcagaacactagattgaacctaaatcct |
27819717 |
T |
 |
| Q |
284 |
ttcaatactttgag-aaaaaagaccactccaaggtatcgaaagctttggttatatctatttttcagaaatagattactaccaaaactttgttgtgtaaaa |
382 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27819716 |
ttcaatactttgagcaaaaaagaccactccaaggtat-aaaagctttggttacatctatttttcagaaatagattactaccaaaactttgttgtgtaaaa |
27819618 |
T |
 |
| Q |
383 |
tgttagttgccttataagcgacacatata |
411 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27819617 |
tgttagttgccttataagcgacacatata |
27819589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 378 - 410
Target Start/End: Complemental strand, 27819590 - 27819558
Alignment:
| Q |
378 |
taaaatgttagttgccttataagcgacacatat |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27819590 |
taaaatgttagttgccttataagcgacacatat |
27819558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University