View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2153_low_10 (Length: 251)
Name: NF2153_low_10
Description: NF2153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2153_low_10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 251
Target Start/End: Complemental strand, 40406113 - 40405881
Alignment:
| Q |
19 |
ttcaatggcaccctccctcaagaactctctaacctcttcaatcttcaagttcttgacctctacaacaacaacatgaccggttcacttcctgtttcggtca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40406113 |
ttcaatggcaccctccctcaagaactctctaacctcttcaatcttcaagttcttgacctctacaacaacaacatgaccggttcacttcctgtttcggtca |
40406014 |
T |
 |
| Q |
119 |
cccatctttcttttctccgccatttgcatcttggtggtaacttcttcaccggaaaaataccaccggagtatggctcttggactcatttagaatatcttgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40406013 |
cccatctttcttttctccgccatttgcatcttggtggtaacttcttcaccggaaaaataccaccggagtatggctcttggactcatttagaatatcttgc |
40405914 |
T |
 |
| Q |
219 |
tgtttctggtaatgaactttccggtcacattcc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40405913 |
tgtttctggtaatgaactttccggtcacattcc |
40405881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 98
Target Start/End: Original strand, 4977241 - 4977274
Alignment:
| Q |
65 |
aagttcttgacctctacaacaacaacatgaccgg |
98 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
4977241 |
aagttcttgatctctacaacaacaacatgaccgg |
4977274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University