View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2153_low_17 (Length: 203)
Name: NF2153_low_17
Description: NF2153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2153_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 11 - 186
Target Start/End: Original strand, 36323845 - 36324022
Alignment:
| Q |
11 |
attatactaagtaagtaatcccaagctcagtggttgatgacatgagaagatcaatagatgatgtataaactgaaatatcaatattgattttctc--gtca |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36323845 |
attatacaaagtaagtaatcccaagctcagtggttgatgacatgagaagatcaatagatgatgtataaactgaaatatcaatattgattttctcgtgtca |
36323944 |
T |
 |
| Q |
109 |
acggttgagattacatactttacatctaaagtgaagcaatgtgtcgtgactagagcgacattgaaccatccaaaaagc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36323945 |
acggttgagattacatactttacatctaaagtgaagcaatgtgtcgtgactagagcgacattgaaacatccaaaaagc |
36324022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University