View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21540_high_16 (Length: 239)
Name: NF21540_high_16
Description: NF21540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21540_high_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 60 - 148
Target Start/End: Complemental strand, 31574877 - 31574789
Alignment:
| Q |
60 |
gtttctcttttcacttcgtaaaattctattagatcaactttgtctaaacaaatcaaccactataatcacttggctcttgaaaactctgg |
148 |
Q |
| |
|
||||||||||||||||| |||| |||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31574877 |
gtttctcttttcacttcataaatttctataacaacaactttgtctaaacaaatcaaccactataatcacttggctcttgaaaactctgg |
31574789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 77 - 148
Target Start/End: Complemental strand, 38029198 - 38029127
Alignment:
| Q |
77 |
gtaaaattctattagatcaactttgtctaaacaaatcaaccactataatcacttggctcttgaaaactctgg |
148 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38029198 |
gtaaatttctattagatcaactttgtctaaacgaatcaaccactataatcacttggctcttgaaaactctgg |
38029127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 60 - 146
Target Start/End: Complemental strand, 6509679 - 6509593
Alignment:
| Q |
60 |
gtttctcttttcacttcgtaaaattctattagatcaactttgtctaaacaaatcaaccactataatcacttggctcttgaaaactct |
146 |
Q |
| |
|
||||||||||||||||| |||| |||||| | | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6509679 |
gtttctcttttcacttcataaatttctataacaacaactttgtctaaacgaatcaaccactataatcacttggctcttgaaaactct |
6509593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University