View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21540_high_23 (Length: 227)
Name: NF21540_high_23
Description: NF21540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21540_high_23 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 116 - 227
Target Start/End: Original strand, 15764168 - 15764279
Alignment:
| Q |
116 |
ttaattttatcacttaaggtttacatgcactcatttttatgctgaaaaattcgtttgtttctttctttctaaaatatccaaacgctattcaagccaaata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | | || ||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
15764168 |
ttaattttatcacttaaggtttacatgcactcatctctgtgttgaaaaattcgtttgtttctttctttctaaataatccaaacactactcaagccaaata |
15764267 |
T |
|
| Q |
216 |
atattaaaacct |
227 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
15764268 |
atatcaaaacct |
15764279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 15762912 - 15762995
Alignment:
| Q |
7 |
tatatatgtaaataattatttaaattggtcatattggcattagtttgtataaaacaatgctattattcactttccttttgataa |
90 |
Q |
| |
|
|||||||| || |||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15762912 |
tatatatgaaattaattatttaaattagtcatattggcattagtttttataaaacgatgctattattcactttccttttgataa |
15762995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University