View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21540_low_23 (Length: 234)
Name: NF21540_low_23
Description: NF21540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21540_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 38 - 219
Target Start/End: Original strand, 40195347 - 40195530
Alignment:
| Q |
38 |
aaattggtgactat--gtaacatcttgttttgctatatcttgtaggtgatttttcatgcacatttgaagttcaaagtgtaattcctattttgaagaatgt |
135 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40195347 |
aaattggtgactatatgtaacatcttgttttgttatatcttgtaggtgatttttcatgcacatttgaagttcaaagtgtaattcctattttgaagaatgt |
40195446 |
T |
 |
| Q |
136 |
atatggtgaaaatatgaaaaatatcttgcatgttggccctgagagttgttcagtggtatccaaattgttaaaaagggaagttga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40195447 |
atatggtgaaaatatgaaaaatatcttgcatgttggccctgagagttgttcagtggtatccaaattgttaaaaggggaagttga |
40195530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University