View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21540_low_7 (Length: 333)
Name: NF21540_low_7
Description: NF21540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21540_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 105 - 319
Target Start/End: Complemental strand, 32856647 - 32856437
Alignment:
| Q |
105 |
ttcatcatgaaaatcagcatagtgtataagtgtagatcaaggtcatcgtatgctggctggagactggagattgtttctgaactaaaactaattgatccgt |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856647 |
ttcatcatgaaaatcagcacagtgtataagtgtagatcaaggtcatcgta----cgctggagactggagattgtttctgaactaaaactaattgatccgt |
32856552 |
T |
|
| Q |
205 |
caacaacaccaccatcacagattcacaatctcactttcactgtcatagaacagagtcctccgccacaaccgtagcggcatcaggtatatcttccactgcc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856551 |
caacaacaccaccatcacagattcacaatctcactctcaccgtcatagaacagagtcctccgccacaaccgtagcggcatcaggtatatcttccactgcc |
32856452 |
T |
|
| Q |
305 |
atctctttcagtgaa |
319 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32856451 |
atctctttcagtgaa |
32856437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 32856635 - 32856744
Alignment:
| Q |
4 |
ttttcatgatgaatatgactgatttctgttttccatttcgaatgtatatctatctaatgttacgaaatatttgtaggtaatgtccatgagttcattcaga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32856635 |
ttttcatgatgaatatgactgatttctgttttccatttcgaatgtatatctatctaatattacgaaatatttgcaggtaatgtccatgagttcattcaga |
32856734 |
T |
|
| Q |
104 |
tttcatcatg |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
32856735 |
tttcatcatg |
32856744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University