View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21541_high_3 (Length: 300)

Name: NF21541_high_3
Description: NF21541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21541_high_3
NF21541_high_3
[»] chr8 (1 HSPs)
chr8 (154-284)||(27514459-27514589)
[»] chr4 (3 HSPs)
chr4 (23-142)||(27637431-27637550)
chr4 (72-140)||(37353626-37353694)
chr4 (72-140)||(37365600-37365668)
[»] chr6 (1 HSPs)
chr6 (171-284)||(23016965-23017078)
[»] chr1 (1 HSPs)
chr1 (219-284)||(39209354-39209419)
[»] chr5 (2 HSPs)
chr5 (155-214)||(36407015-36407074)
chr5 (162-214)||(18449208-18449260)


Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 154 - 284
Target Start/End: Complemental strand, 27514589 - 27514459
Alignment:
154 tatcataatattataaatggaacacaaacctgcaagtttgccctaatttaatcctttgaaaatccatcattttgaactgcagttcaccgggcgggaaaaa 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||    
27514589 tatcataatattataaatggaacacaaacctgcaagtttgccctaatttaatcctttgaaaatccatcattttcaactgcagttaatcgggcgggaaaaa 27514490  T
254 atttatttatgaatttttgggacaaaattac 284  Q
     || ||| |||| ||||||||||||||||||    
27514489 tttaattaatgagtttttgggacaaaattac 27514459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 23 - 142
Target Start/End: Complemental strand, 27637550 - 27637431
Alignment:
23 tcgatttaaaagtgatattattttcaaaactgttattacaatagatcatctatgctatgatgattatcaatatgatatttatgagtttaatttagtttca 122  Q
    ||||||||||| |||||||| | |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27637550 tcgatttaaaattgatattactgtcaaaaatgttattacaatagctcatctatgctatgatgattatcaatatgatatttatgagtttaatttagtttca 27637451  T
123 tggtgtttcatttattttgt 142  Q
    || |||||||||||||||||    
27637450 tgatgtttcatttattttgt 27637431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 37353694 - 37353626
Alignment:
72 ctatgctatgatgattatcaatatgatatttatgagtttaatttagtttcatggtgtttcatttatttt 140  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||    
37353694 ctatactatgatgattatcaatatgatatttatgagtttaatttagtttcatgttgttacttttatttt 37353626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 37365668 - 37365600
Alignment:
72 ctatgctatgatgattatcaatatgatatttatgagtttaatttagtttcatggtgtttcatttatttt 140  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||    
37365668 ctatactatgatgattatcaatatgatatttatgagtttaatttagtttcatgttgttacttttatttt 37365600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 171 - 284
Target Start/End: Original strand, 23016965 - 23017078
Alignment:
171 tggaacacaaacctgcaagtttgccctaatttaatcctttgaaaatccatcattttgaactgcagttcaccgggcgggaaaaaatttatttatgaatttt 270  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| || ||| |||| ||||    
23016965 tggaacacaaacctgcaagttttccctaatttaatcctttgaaaatccatcattttcaactgcagttcatcgggcgggaaaaatttaattaatgagtttt 23017064  T
271 tgggacaaaattac 284  Q
    ||||||||||||||    
23017065 tgggacaaaattac 23017078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 219 - 284
Target Start/End: Original strand, 39209354 - 39209419
Alignment:
219 atcattttgaactgcagttcaccgggcgggaaaaaatttatttatgaatttttgggacaaaattac 284  Q
    |||||||| ||||||||||| |||||||||||||| || |||||||||||||||||||||||||||    
39209354 atcatttttaactgcagttcgccgggcgggaaaaatttaatttatgaatttttgggacaaaattac 39209419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 155 - 214
Target Start/End: Complemental strand, 36407074 - 36407015
Alignment:
155 atcataatattataaatggaacacaaacctgcaagtttgccctaatttaatcctttgaaa 214  Q
    |||||||||||||||||||||||| || |||||| |||||||||||||  ||||||||||    
36407074 atcataatattataaatggaacaccaagctgcaaatttgccctaatttgttcctttgaaa 36407015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 214
Target Start/End: Complemental strand, 18449260 - 18449208
Alignment:
162 tattataaatggaacacaaacctgcaagtttgccctaatttaatcctttgaaa 214  Q
    ||||||||||||||||| || || ||| |||||||||||||  ||||||||||    
18449260 tattataaatggaacaccaagctccaaatttgccctaatttgctcctttgaaa 18449208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University