View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21541_low_3 (Length: 300)
Name: NF21541_low_3
Description: NF21541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21541_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 154 - 284
Target Start/End: Complemental strand, 27514589 - 27514459
Alignment:
| Q |
154 |
tatcataatattataaatggaacacaaacctgcaagtttgccctaatttaatcctttgaaaatccatcattttgaactgcagttcaccgggcgggaaaaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
27514589 |
tatcataatattataaatggaacacaaacctgcaagtttgccctaatttaatcctttgaaaatccatcattttcaactgcagttaatcgggcgggaaaaa |
27514490 |
T |
|
| Q |
254 |
atttatttatgaatttttgggacaaaattac |
284 |
Q |
| |
|
|| ||| |||| |||||||||||||||||| |
|
|
| T |
27514489 |
tttaattaatgagtttttgggacaaaattac |
27514459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 23 - 142
Target Start/End: Complemental strand, 27637550 - 27637431
Alignment:
| Q |
23 |
tcgatttaaaagtgatattattttcaaaactgttattacaatagatcatctatgctatgatgattatcaatatgatatttatgagtttaatttagtttca |
122 |
Q |
| |
|
||||||||||| |||||||| | |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27637550 |
tcgatttaaaattgatattactgtcaaaaatgttattacaatagctcatctatgctatgatgattatcaatatgatatttatgagtttaatttagtttca |
27637451 |
T |
|
| Q |
123 |
tggtgtttcatttattttgt |
142 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
27637450 |
tgatgtttcatttattttgt |
27637431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 37353694 - 37353626
Alignment:
| Q |
72 |
ctatgctatgatgattatcaatatgatatttatgagtttaatttagtttcatggtgtttcatttatttt |
140 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
37353694 |
ctatactatgatgattatcaatatgatatttatgagtttaatttagtttcatgttgttacttttatttt |
37353626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 37365668 - 37365600
Alignment:
| Q |
72 |
ctatgctatgatgattatcaatatgatatttatgagtttaatttagtttcatggtgtttcatttatttt |
140 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
37365668 |
ctatactatgatgattatcaatatgatatttatgagtttaatttagtttcatgttgttacttttatttt |
37365600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 171 - 284
Target Start/End: Original strand, 23016965 - 23017078
Alignment:
| Q |
171 |
tggaacacaaacctgcaagtttgccctaatttaatcctttgaaaatccatcattttgaactgcagttcaccgggcgggaaaaaatttatttatgaatttt |
270 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| || ||| |||| |||| |
|
|
| T |
23016965 |
tggaacacaaacctgcaagttttccctaatttaatcctttgaaaatccatcattttcaactgcagttcatcgggcgggaaaaatttaattaatgagtttt |
23017064 |
T |
|
| Q |
271 |
tgggacaaaattac |
284 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23017065 |
tgggacaaaattac |
23017078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 219 - 284
Target Start/End: Original strand, 39209354 - 39209419
Alignment:
| Q |
219 |
atcattttgaactgcagttcaccgggcgggaaaaaatttatttatgaatttttgggacaaaattac |
284 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
39209354 |
atcatttttaactgcagttcgccgggcgggaaaaatttaatttatgaatttttgggacaaaattac |
39209419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 155 - 214
Target Start/End: Complemental strand, 36407074 - 36407015
Alignment:
| Q |
155 |
atcataatattataaatggaacacaaacctgcaagtttgccctaatttaatcctttgaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| ||||||||||||| |||||||||| |
|
|
| T |
36407074 |
atcataatattataaatggaacaccaagctgcaaatttgccctaatttgttcctttgaaa |
36407015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 214
Target Start/End: Complemental strand, 18449260 - 18449208
Alignment:
| Q |
162 |
tattataaatggaacacaaacctgcaagtttgccctaatttaatcctttgaaa |
214 |
Q |
| |
|
||||||||||||||||| || || ||| ||||||||||||| |||||||||| |
|
|
| T |
18449260 |
tattataaatggaacaccaagctccaaatttgccctaatttgctcctttgaaa |
18449208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University