View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21542_high_17 (Length: 234)
Name: NF21542_high_17
Description: NF21542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21542_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 218
Target Start/End: Original strand, 27914541 - 27914739
Alignment:
| Q |
21 |
gattatccattaagctttctgtcatatagtggtatgccgaccttaggatgtactctccatgtgatgtgaatttccaagaacacttatgtgaa-ttggcat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
27914541 |
gattatccattaagctttctgtcatatagtggtatgccgaccttaggatgtactctccatgtgatgtgaatttcctagaacacttatgtgaaattggcat |
27914640 |
T |
|
| Q |
120 |
aatcaagatttgatttgccacttgaggattgaagtagaaattaaccagatcaactatccattttccagtgtcactatctattaactctcccgccttcat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27914641 |
aatcaagatttgatttgccacttgaggattgaagtagaaattaaccagatcaactatccattttccagtgtcactatctattaactctcccgccttcat |
27914739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 117 - 207
Target Start/End: Original strand, 10370319 - 10370409
Alignment:
| Q |
117 |
cataatcaagatttgatttgccacttgaggattgaagtagaaattaaccagatcaactatccattttccagtgtcactatctattaactct |
207 |
Q |
| |
|
|||| |||| |||| |||||||||||||||||| |||||||||||| | ||||||| | ||||||| |||| |||||||||||||||| |
|
|
| T |
10370319 |
catagtcaaaatttaatttgccacttgaggattaaagtagaaattagctgaatcaacttttcattttctagtggtactatctattaactct |
10370409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 100
Target Start/End: Original strand, 10370207 - 10370286
Alignment:
| Q |
21 |
gattatccattaagctttctgtcatatagtggtatgccgaccttaggatgtactctccatgtgatgtgaatttccaagaa |
100 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||| |||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
10370207 |
gattatccattaagctttttgtgatataatggtatgcaaaccttacatggtgctctccatgtgatgtaaatttccaagaa |
10370286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University