View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21542_low_14 (Length: 252)
Name: NF21542_low_14
Description: NF21542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21542_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 4898681 - 4898889
Alignment:
| Q |
15 |
agaagaactttaaatttagtgaaattgacaaagaacaaaggttgtcaaacctggtgataagtggttctaacatcaaaagacattcatgtccctctcaatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4898681 |
agaagaactttaaatttagtgaaattgacaaagaacaaaggttgtcaaacctggtgataagtggttctaacatcaaaagacattcatgcccctctcaatc |
4898780 |
T |
 |
| Q |
115 |
caactatacacctctttatttgcgtataggcttccacgaataattactttacctagaaaacactagagtagaccgtaactcaaaaacaaagctaccataa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4898781 |
caactatacacctctttatttgcgtataggcttccacgaataattacttttcctagaaaacgctagagtagaccgtaactcaaaaacaaagctaccataa |
4898880 |
T |
 |
| Q |
215 |
tttaatata |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
4898881 |
tttaatata |
4898889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University