View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21543_low_18 (Length: 223)
Name: NF21543_low_18
Description: NF21543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21543_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 45129048 - 45129240
Alignment:
| Q |
19 |
atattagtccatgtgaccaaaagaattcagcccttgaattgaaatcagttgcatattctagaactggatttcccaactgcaattcaactttggtatcaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45129048 |
atattagtccatgtgaccaaaagaattcagcccttgaattgaaatcagttgcatattctagaactggatttcccaactgcaattcaactttggtatcaac |
45129147 |
T |
 |
| Q |
119 |
agctagcaaattgtatggaatnnnnnnnntcatcaatgtagcattacttaccgctatgcctttaaggttgaatatcttgtttcttttgttcat |
211 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45129148 |
agctagcaaattgtatggaataaaaaaaatcatcaatgtagccttacttacggctatgcctttaaggttgaatatcttgtttcttttgttcat |
45129240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 26 - 101
Target Start/End: Original strand, 40280910 - 40280985
Alignment:
| Q |
26 |
tccatgtgaccaaaagaattcagcccttgaattgaaatcagttgcatattctagaactggatttcccaactgcaat |
101 |
Q |
| |
|
|||||| ||||| ||||| ||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
40280910 |
tccatgagaccagaagaactcagcccttgaattgaagtcagtggcatattctagaagtggatttcccaactgcaat |
40280985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 26 - 88
Target Start/End: Original strand, 6632284 - 6632346
Alignment:
| Q |
26 |
tccatgtgaccaaaagaattcagcccttgaattgaaatcagttgcatattctagaactggatt |
88 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||| ||||| |||||| |||||| ||||||||| |
|
|
| T |
6632284 |
tccatgagaccaaaagaactcagctcttgaattaaaatctgttgcaaattctaaaactggatt |
6632346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University