View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21544_low_3 (Length: 290)
Name: NF21544_low_3
Description: NF21544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21544_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 21 - 285
Target Start/End: Complemental strand, 24329368 - 24329104
Alignment:
| Q |
21 |
tattattgtggcaactgctatgatgttgatcattaacgaaactgatagcctgaggtattttgacagcaatagcagcaagctcatcatttggcagatagtc |
120 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24329368 |
tattattgtggcaactgccatgatgttgatcgttaacgaaactgatagcctgaggtattttgacagcaatagcagcaagctcatcatttggcagatagtc |
24329269 |
T |
 |
| Q |
121 |
ggtgtcctgactcgcatccccttgcccgagctttactgaaaacaaaacaaactctttcatggtagatgagtccacacaattctgtccagttaaatccaag |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24329268 |
ggtgtcctgactcgtatccccttgcccgagctttactgaaaacaaaacaaactctttcatggtagatgagtccacacaattctgtccagttaaatccaag |
24329169 |
T |
 |
| Q |
221 |
cagtgtgaatcagaagccttcatttgagcgacagcatgggaaacataatcaggtcctttgcttct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24329168 |
cagtgtgaatcagaagccttcatttgagcgacagcatgggaaacataatcaggtcctttgcttct |
24329104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University