View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21545_high_24 (Length: 261)
Name: NF21545_high_24
Description: NF21545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21545_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 143 - 245
Target Start/End: Complemental strand, 7172606 - 7172504
Alignment:
| Q |
143 |
ttgctgatatgtgattgagttggtaaacatcaattgatgatttaagttgtggattgtagttcttttagacaaggctttctttagatggtttattgctaat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7172606 |
ttgctgatatgtgattgagttggtaaacatcaattgatgatttaagttgtggattgtagttcttttagacaaggctttctttagatggtttattgctaat |
7172507 |
T |
|
| Q |
243 |
att |
245 |
Q |
| |
|
||| |
|
|
| T |
7172506 |
att |
7172504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 106
Target Start/End: Complemental strand, 7172693 - 7172604
Alignment:
| Q |
17 |
aaaaactatagatgaggaaacaatggtgaaataattcagtttggtagagtgagataaatgtttagagaagataaatgagcacagaatttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7172693 |
aaaaactatagatgaggaaacaatggtgaaataattcagtttggtagagtgagataaatgtttagagaagataaatgagcacagaatttg |
7172604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University