View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21545_high_26 (Length: 250)
Name: NF21545_high_26
Description: NF21545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21545_high_26 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 98 - 250
Target Start/End: Original strand, 26845127 - 26845280
Alignment:
| Q |
98 |
tcaacatatcacttgtgatgttaatgtttaaccgatagatttggatcctctacggccactttatggtgcagcagccgtaggaactgatagatttggtttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26845127 |
tcaacatatcacttgtgatgttaatgtttaaccgatagatttggatcctctacggccactttatggtgcagcagcggtaggaactgatagatttggtttc |
26845226 |
T |
 |
| Q |
198 |
gtgttagattcgttgtgaacaacactcatcgaat-aaaaggccaaaatgttcaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
26845227 |
gtgttagattcgttgtgaacaacactcgtcaaataaaaaggccaaaatgttcaa |
26845280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 26845060 - 26845110
Alignment:
| Q |
16 |
atgtcataatttaatttcaaaatatttgcattccaactatttatttgattatatt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26845060 |
atgtcataatttaatttcaaaatatttgcattccaac----tatttgattatatt |
26845110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University