View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21545_high_33 (Length: 211)
Name: NF21545_high_33
Description: NF21545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21545_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 35277466 - 35277643
Alignment:
| Q |
15 |
caaaggggagaaaaagcataaagtgtatgaaatatttcaatatccaannnnnnncataaaaggaacgtgtttgttaagtaatttatatttgtttttgtca |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35277466 |
caaaagggagaaaaagcataaagtgtatgaaatatttcaatatccaatttttttcataaaaggaacgtgtttgttaagtaatttatatttgtttttgtca |
35277565 |
T |
|
| Q |
115 |
gnnnnnnnnngtaatgaattgttattccataattgttttttagaggaattaataaattgttatctgtacgtatattgc |
192 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35277566 |
gaaaaaaaaagtaatgaattgttattccataattgttttttagaggaattaataaattgttatctgtacttatattgc |
35277643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University