View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21545_low_22 (Length: 324)
Name: NF21545_low_22
Description: NF21545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21545_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 161 - 310
Target Start/End: Original strand, 55170065 - 55170214
Alignment:
| Q |
161 |
cctgaaccgtttccaaaatatttggttaaaagttgatgaataatgaaggctatcatttgatggagtttggtaacattattatgttgtcattgacaaacac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
55170065 |
cctgaaccgtttccaaaatatttggttaaaagttgatgaataatgaaggctatcatttgatggagtttggtaacattattgttttgtcattgacaaacac |
55170164 |
T |
 |
| Q |
261 |
caactttagatacgtacagatctatatcaacctgtctcacagttatactt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55170165 |
caactttagatacgtacagatctatatcaacctgtctcacagttatactt |
55170214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University