View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21545_low_23 (Length: 270)
Name: NF21545_low_23
Description: NF21545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21545_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 74 - 216
Target Start/End: Original strand, 40465000 - 40465143
Alignment:
| Q |
74 |
attgccaaagtcaaatattgttggaacatagagtactgttccaactctaatcaaatagacaaaggtgcac-tacaggtactgcagaataggatgctgcaa |
172 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||| |||||||||||| |
|
|
| T |
40465000 |
attgtcaaagtcaaatattgttggaacatagagtactgttccaactctaatcaaatagccaaaggtacaggtacaggtactgcagaagaggatgctgcaa |
40465099 |
T |
 |
| Q |
173 |
accagtacaaaacactatgcttaggagttgctctgccgagttgg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
40465100 |
accagtacaaaacactatgcttaggagtttctctgccgtgttgg |
40465143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 212 - 258
Target Start/End: Complemental strand, 40465208 - 40465162
Alignment:
| Q |
212 |
gttggttccatggttaggcaggtccatccaattgaatcttgcaagtg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40465208 |
gttggttccatggttaggcaggtccatccaattgaattttgcaagtg |
40465162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University