View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21545_low_30 (Length: 247)
Name: NF21545_low_30
Description: NF21545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21545_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 239
Target Start/End: Original strand, 341364 - 341596
Alignment:
| Q |
8 |
gagtagtacaacaattaagcatcacataaataaacaatcttaagtgaaagaagagggaaggacgactccaacaactttatttctcaagaaacacattatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
341364 |
gagtagtacaacaattaagcatcacataaataaacaatcttaagcgagagaagagggaaggacgactccaacaactttatttctcaagaaacacattatg |
341463 |
T |
 |
| Q |
108 |
atgaagaatgacactagggataacgctgcttttactc--tgataaaaattgattgaaatattctaacacattcaccaaaggactccccaaccaattatcc |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
341464 |
atgaagaatgacactagggataacactgcttttactctatgatacaaattgattgaaatattc-aacacattcaccaaaggacaccccaaccaattatcc |
341562 |
T |
 |
| Q |
206 |
atgccattagacatatgtttcttaattcgtgtct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
341563 |
atgccattagacatatgtttcttaattcgtgtct |
341596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University