View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21545_low_31 (Length: 243)
Name: NF21545_low_31
Description: NF21545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21545_low_31 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 51393493 - 51393715
Alignment:
| Q |
19 |
actgaaactaactttttattattattattataaattcatatagaacaattagtcttggactcgtaggattgatatccaacgttgaattaattaatctgtt |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51393493 |
actgaaactaacttttt--tattattattataaattcatatagaacaattagtcttggcctcgtaggattgatatccaacgttgaattaattaatctgtt |
51393590 |
T |
|
| Q |
119 |
ggagtcaccgatcaatttggccaattatacatgaattcccataatcctgtttgtccatttaaaccataaataccttcagaagccactagccatgaacatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51393591 |
ggagtcaccgatcaatttggccaattatacatgaattcccataatcctgtttgtccatttaaaccataaataccttcagaagccactagccatgaacatc |
51393690 |
T |
|
| Q |
219 |
cagtgtcacatcgtacgtggtccct |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
51393691 |
cagtgtcacatcgtacgtggtccct |
51393715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University