View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21545_low_33 (Length: 235)
Name: NF21545_low_33
Description: NF21545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21545_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 12 - 219
Target Start/End: Complemental strand, 2054276 - 2054074
Alignment:
| Q |
12 |
agatgaacgtacacgatatcatatataatgtttgtattttgatgttcaaatgatacannnnnnnn--gttttagatgatgaagtggtaatccactaaaat |
109 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||| ||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
2054276 |
agatgaacgtacacgatat----tataatgtttgtactttgatgttcaaataatacatttttgttttgttttagatga---agtggtaatccactgaaat |
2054184 |
T |
 |
| Q |
110 |
catacacattttttaattactataaactaattaatgttgtgattgaattttaggtatataataatccttcttgtcatatatcaannnnnnnaaagcttat |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
2054183 |
catacacattttttaattactatgaactaattaatgttgtgattgaattttaggtatataataatccttcttgtcacatatcaatttttttaaagcttat |
2054084 |
T |
 |
| Q |
210 |
atgaacaaat |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
2054083 |
atgaacaaat |
2054074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University