View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21545_low_34 (Length: 219)
Name: NF21545_low_34
Description: NF21545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21545_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 25417212 - 25417413
Alignment:
| Q |
14 |
catatactacataattaaagcaaatataattataaatctaagcatcgaaagcaaaaattgaaaacgaagtatgcagaatctgaatgttggaagtttgatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25417212 |
catatactacataattaaagcaaatataattataaatctaagcatcgaaagcaaaaattgaaaacgaagtatgcagaatctgaatgttggtagtttgatt |
25417311 |
T |
 |
| Q |
114 |
tatgcatacctttaccgatcacgaacggagcggaagcaga---------------gacggagtatgcggttgaggatgcagtgaggcggtctagggttct |
198 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25417312 |
tatgcatacctttaccgatgacgaacggagcggaagcagagacggagagaggagcgacggagtatgcggttgaggatgcagtgatgcggtctagggttct |
25417411 |
T |
 |
| Q |
199 |
tc |
200 |
Q |
| |
|
|| |
|
|
| T |
25417412 |
tc |
25417413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 74 - 127
Target Start/End: Complemental strand, 11729050 - 11728997
Alignment:
| Q |
74 |
aaaacgaagtatgcagaatctgaatgttggaagtttgatttatgcataccttta |
127 |
Q |
| |
|
||||| ||| |||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11729050 |
aaaacaaagaatgcagaacctgtatgttggaagtttgatttatgcataccttta |
11728997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 25411971 - 25412029
Alignment:
| Q |
57 |
atcgaaagcaaaaattgaaaacgaagtatgcagaatctgaatgttggaagtttgattta |
115 |
Q |
| |
|
|||||| | ||||||||||||| ||||||| |||||||| || |||||||||||||||| |
|
|
| T |
25411971 |
atcgaacggaaaaattgaaaacaaagtatgtagaatctgtatcttggaagtttgattta |
25412029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 66 - 127
Target Start/End: Original strand, 11730434 - 11730494
Alignment:
| Q |
66 |
aaaaattgaaaacgaagtatgcagaatctgaatgttggaagtttgatttatgcataccttta |
127 |
Q |
| |
|
|||||||||||| ||| ||||||||| | | ||||||||||||||| |||||||||||||| |
|
|
| T |
11730434 |
aaaaattgaaaataaagaatgcagaatttta-tgttggaagtttgatatatgcataccttta |
11730494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University