View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21546_high_12 (Length: 248)
Name: NF21546_high_12
Description: NF21546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21546_high_12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 248
Target Start/End: Complemental strand, 34626444 - 34626192
Alignment:
| Q |
9 |
caaaggttgcctatgcatatggaaaaaggcgatgacggtacattcgagagaaatctatgaaagaaattttaaaacatttgtttaaatgtatggatagatt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34626444 |
caaaggttgcctatgcatatggaaaaaggggatgacggtacattcgagagaaatctatgaaagaaattttaaaacatttgtttaaatgtatggatagatt |
34626345 |
T |
 |
| Q |
109 |
caatagaataaaattttaattattaagcaccaataaaaggtacctgctttataggattcgactgaccctgtgaaagcaaagttg-------------ttg |
195 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34626344 |
cgatagaataaaattttaattattaagcaccaataaaaggtacctgctttataggattcgactgaccctgtgaaagcaaagttgttgcaatgatttgttg |
34626245 |
T |
 |
| Q |
196 |
cctttgcgttgcaatgtttgtctaagtctaaccttagtacccttagatttctt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34626244 |
cctttgcgttgcaatgtttgtctaagtctaaccttagtacccttagatttctt |
34626192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University