View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21546_high_13 (Length: 240)
Name: NF21546_high_13
Description: NF21546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21546_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 2 - 222
Target Start/End: Complemental strand, 29009010 - 29008790
Alignment:
| Q |
2 |
tattcattcaattagatgaagaatttgaatcgaagctatagttaactctgtgnnnnnnnnnnnnnnnnnnnnnnnntaggaaaatgaggccagtctgggc |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29009010 |
tattcattcgattagatgaagaatttgaatcgaagctatagttaactctgtgtttttgattttttggtttgatttgtaggaaaatgaggccagtctgggc |
29008911 |
T |
|
| Q |
102 |
agtgaaagctatgttcgtggtcgtcttggcttcaattctcttccgttgcgtttgtggtggtaaccacaccgttggtggtgcttccgcctgggatcttgaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29008910 |
agtgaaagctatgttcgtggtcgtcttggcttcgattctcttccgttgcgtttgtggtggtaaccacaccgttggtggtgcttccgcctgggatcttgaa |
29008811 |
T |
|
| Q |
202 |
tccaatatgcaggtttgggct |
222 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
29008810 |
tccaatatgcaggattgggct |
29008790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University