View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21546_high_14 (Length: 238)
Name: NF21546_high_14
Description: NF21546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21546_high_14 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 34625859 - 34626082
Alignment:
| Q |
16 |
catggtggaatactacgaccaatatcactgataaattgagttcgtcaggtcacaattaaaatttgcgtatgcacttgcgttatggtagtagtcttagcac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34625859 |
catggtggaatactacgaccaatatcactgataaattgagttcgtcaggtcacaattaaaatttgcgtatgcacttgtgttatggtagtagtcttagcac |
34625958 |
T |
|
| Q |
116 |
catggtagaaattctagtgactcggggcaatgcaccag-ccccccgccacacacgcaatgaccacatccttcgtcaaacaacaaattgatatgagcacaa |
214 |
Q |
| |
|
||| |||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34625959 |
cattgtagaagtcctagtgactcggggcaatgcaccagcccccccgccacacacgcaatgaccacatccttcgtcaaacaacaaattgatatgagcacaa |
34626058 |
T |
|
| Q |
215 |
atgacatcatgtatcaagtctctc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34626059 |
atgacatcatgtatcaagtctctc |
34626082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University