View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21546_low_10 (Length: 271)
Name: NF21546_low_10
Description: NF21546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21546_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 53 - 254
Target Start/End: Original strand, 38918677 - 38918878
Alignment:
| Q |
53 |
gtcgctgctgctcggagttttagaaggagttttcgacgacttaggagctggagatgaagatggagacttagcaccaaaaagttcagaaggtaacaaaacc |
152 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918677 |
gtcgctgctgctcggagttttggaaggagttttcgacgacttaggagctggagatgaagatggagacttagcaccaaaaagttcagaaggtaacaaaacc |
38918776 |
T |
|
| Q |
153 |
ttgtccaattgataaacagccaaaggaaattgttgtctcaaagcattgttgataggtacagtaacaactccagttgaaacattgacttggttaccttgtg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918777 |
ttgtccaattgataaacagccaaaggaaattgttgtctcaatgcattgttgataggtacagtaacaactccagttgaaacattgacttggttaccttgtg |
38918876 |
T |
|
| Q |
253 |
aa |
254 |
Q |
| |
|
|| |
|
|
| T |
38918877 |
aa |
38918878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 38918650 - 38918592
Alignment:
| Q |
1 |
gtctagtaagaaggatgatagtgcagctggaaggaatgtcggttttggatttgtcgctg |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38918650 |
gtctagtaagaaggatgatagtgcagctggaaggaatgtcggttttggatttgttgctg |
38918592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University