View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21547_low_8 (Length: 255)
Name: NF21547_low_8
Description: NF21547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21547_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 65 - 238
Target Start/End: Original strand, 34479351 - 34479524
Alignment:
| Q |
65 |
aatatttggtaggtttggactataaataagatgcatgcaggattggtgatgaatctgtgtgcagagcaacaatggcacgtgtgaagaactttaaggatan |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
34479351 |
aatatttggtaggtttggactataaataagatgcatgcaggattggtgatgaatctgtgtgcagagcaacaattgcacgtgtgaagaattttaaggattt |
34479450 |
T |
 |
| Q |
165 |
nnnnnngttaaagtaaaatatattaataaccacattcttgcacaatataaagagagatcaataagaccgaaatt |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
34479451 |
ttttttgttaaagtaaaatgtattaataaccacattcttgcataatataaacagagatcaataagaccaaaatt |
34479524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University