View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21547_low_9 (Length: 241)
Name: NF21547_low_9
Description: NF21547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21547_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 227
Target Start/End: Original strand, 36620861 - 36621083
Alignment:
| Q |
5 |
ggagtggtggagaatacagtttggcgattaatcatacggaggaagagatgctcgaatggggaatgtctcctgatatgattgctgatcagaaatggcgtgc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36620861 |
ggagtggtggagaatacagtttggcgattaatcatacggaggaagagatgctcgaatggggaatgtctcctgatatgattgctgatcagaaatggcgtgc |
36620960 |
T |
|
| Q |
105 |
agatgcgcctagaggtgcttggaatgatcaatgtccttggtatcttgatggnnnnnnngatcgttttgatgcatctgaatctgatgatgacactgaagca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36620961 |
agatgcgcctagaggtgcttggaatgatcaatgtccttggtatcttgatggtttttttgatcgttttgatgcatctgaatctgatgatgacactgaagca |
36621060 |
T |
|
| Q |
205 |
atccaaaatgaaggtgaaactga |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36621061 |
atccaaaatgaaggtgaaactga |
36621083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 104
Target Start/End: Complemental strand, 46967975 - 46967876
Alignment:
| Q |
5 |
ggagtggtggagaatacagtttggcgattaatcatacggaggaagagatgctcgaatggggaatgtctcctgatatgattgctgatcagaaatggcgtgc |
104 |
Q |
| |
|
||||||||||||| ||||| ||||| || ||||||| || ||||| |||| || ||||| | |||||||||||| | || ||||||||||||||||| |
|
|
| T |
46967975 |
ggagtggtggagagtacagcttggcagttcatcatacagatgaagaactgcttgagtgggggctctctcctgatatggtagccgatcagaaatggcgtgc |
46967876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University