View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21548_low_9 (Length: 248)

Name: NF21548_low_9
Description: NF21548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21548_low_9
NF21548_low_9
[»] chr5 (1 HSPs)
chr5 (21-238)||(31996927-31997143)
[»] chr6 (1 HSPs)
chr6 (79-127)||(24011575-24011622)


Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 238
Target Start/End: Complemental strand, 31997143 - 31996927
Alignment:
21 tttgcaaccatgttactgtctatatccacttacgatattgtataccgaataattgttgtgcatactgtaaggtctaaacttgccttaatcagaaaataac 120  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||     
31997143 tttgcaaccatgttactgtctatatccacttacgattttgtataccgaataattgctgtgcatactgtaaggtctaaacttgccttaatcagaaagtaa- 31997045  T
121 tctagcacaagaaataacaacatatcaatatcagagagatttgagtaagtaagaaataatatacagaaaatagtttgcaaaaaatagtcattgtaaaaca 220  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
31997044 tctagcaaaagaaataacaacatatcaatatcagagagatttgagtatgtaagaaataatatacagaaaatagtttgcaaaaaatagtcattgtaaaaca 31996945  T
221 atatagcttcaccctttg 238  Q
    ||||||||||||||||||    
31996944 atatagcttcaccctttg 31996927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 127
Target Start/End: Complemental strand, 24011622 - 24011575
Alignment:
79 tgcatactgtaaggtctaaacttgccttaatcagaaaataactctagca 127  Q
    ||||| || ||| ||||||||||||||||||||| ||||||||||||||    
24011622 tgcattctctaaagtctaaacttgccttaatcag-aaataactctagca 24011575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University