View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21548_low_9 (Length: 248)
Name: NF21548_low_9
Description: NF21548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21548_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 238
Target Start/End: Complemental strand, 31997143 - 31996927
Alignment:
| Q |
21 |
tttgcaaccatgttactgtctatatccacttacgatattgtataccgaataattgttgtgcatactgtaaggtctaaacttgccttaatcagaaaataac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31997143 |
tttgcaaccatgttactgtctatatccacttacgattttgtataccgaataattgctgtgcatactgtaaggtctaaacttgccttaatcagaaagtaa- |
31997045 |
T |
|
| Q |
121 |
tctagcacaagaaataacaacatatcaatatcagagagatttgagtaagtaagaaataatatacagaaaatagtttgcaaaaaatagtcattgtaaaaca |
220 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31997044 |
tctagcaaaagaaataacaacatatcaatatcagagagatttgagtatgtaagaaataatatacagaaaatagtttgcaaaaaatagtcattgtaaaaca |
31996945 |
T |
|
| Q |
221 |
atatagcttcaccctttg |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31996944 |
atatagcttcaccctttg |
31996927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 127
Target Start/End: Complemental strand, 24011622 - 24011575
Alignment:
| Q |
79 |
tgcatactgtaaggtctaaacttgccttaatcagaaaataactctagca |
127 |
Q |
| |
|
||||| || ||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24011622 |
tgcattctctaaagtctaaacttgccttaatcag-aaataactctagca |
24011575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University