View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2154_high_5 (Length: 235)

Name: NF2154_high_5
Description: NF2154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2154_high_5
NF2154_high_5
[»] chr1 (290 HSPs)
chr1 (102-220)||(31060785-31060903)
chr1 (104-220)||(3247198-3247314)
chr1 (104-220)||(8140434-8140550)
chr1 (104-219)||(19720712-19720827)
chr1 (102-220)||(40718108-40718226)
chr1 (102-220)||(45380520-45380638)
chr1 (103-220)||(35056529-35056646)
chr1 (100-220)||(10631160-10631280)
chr1 (104-220)||(15526246-15526362)
chr1 (104-220)||(24507727-24507843)
chr1 (104-220)||(30322929-30323045)
chr1 (104-219)||(12360853-12360968)
chr1 (102-220)||(24653800-24653918)
chr1 (104-220)||(38164179-38164295)
chr1 (104-220)||(47819480-47819596)
chr1 (102-220)||(38151096-38151214)
chr1 (104-216)||(10887486-10887598)
chr1 (104-216)||(39747723-39747835)
chr1 (105-218)||(44157696-44157809)
chr1 (104-220)||(33000305-33000421)
chr1 (104-215)||(26324585-26324696)
chr1 (103-218)||(33234798-33234913)
chr1 (101-219)||(12322855-12322973)
chr1 (104-218)||(34002827-34002940)
chr1 (101-215)||(48955955-48956069)
chr1 (99-218)||(28507344-28507463)
chr1 (105-215)||(18928031-18928141)
chr1 (104-218)||(24978008-24978122)
chr1 (101-219)||(35307996-35308114)
chr1 (104-220)||(16026573-16026690)
chr1 (107-219)||(8364619-8364731)
chr1 (104-208)||(15211511-15211615)
chr1 (107-219)||(15335180-15335292)
chr1 (104-219)||(36912853-36912963)
chr1 (104-219)||(50429095-50429209)
chr1 (102-192)||(38136893-38136983)
chr1 (103-218)||(39025269-39025382)
chr1 (103-219)||(44641320-44641433)
chr1 (104-218)||(49073691-49073805)
chr1 (102-219)||(7001782-7001899)
chr1 (104-219)||(14007489-14007601)
chr1 (101-159)||(24977775-24977833)
chr1 (107-220)||(46183938-46184051)
chr1 (104-218)||(21383104-21383215)
chr1 (104-212)||(26442563-26442671)
chr1 (104-192)||(30323205-30323293)
chr1 (104-192)||(33000581-33000669)
chr1 (104-192)||(35056806-35056894)
chr1 (104-192)||(45380272-45380360)
chr1 (104-200)||(45638798-45638894)
chr1 (104-219)||(48609236-48609349)
chr1 (104-219)||(990265-990379)
chr1 (104-219)||(7818988-7819103)
chr1 (104-160)||(7867301-7867357)
chr1 (104-219)||(13770489-13770603)
chr1 (104-219)||(29072497-29072612)
chr1 (106-192)||(4789310-4789396)
chr1 (107-205)||(5058891-5058989)
chr1 (104-159)||(15516582-15516637)
chr1 (99-200)||(42482974-42483076)
chr1 (104-218)||(50428873-50428987)
chr1 (104-213)||(7867129-7867238)
chr1 (104-216)||(19622655-19622767)
chr1 (107-192)||(19720986-19721071)
chr1 (104-219)||(22919684-22919796)
chr1 (104-217)||(26442786-26442899)
chr1 (107-192)||(38150851-38150936)
chr1 (98-219)||(41358549-41358669)
chr1 (106-160)||(45368793-45368847)
chr1 (99-192)||(47819227-47819320)
chr1 (104-196)||(8140707-8140799)
chr1 (104-192)||(10887233-10887321)
chr1 (173-218)||(19622905-19622950)
chr1 (104-192)||(24654079-24654167)
chr1 (174-219)||(34492303-34492348)
chr1 (107-218)||(4617091-4617202)
chr1 (104-160)||(6567440-6567496)
chr1 (104-219)||(18473272-18473386)
chr1 (104-160)||(21391096-21391152)
chr1 (101-192)||(24507476-24507567)
chr1 (102-194)||(25658012-25658103)
chr1 (104-219)||(31258339-31258454)
chr1 (104-160)||(33045634-33045690)
chr1 (104-219)||(35307715-35307830)
chr1 (104-219)||(41881093-41881208)
chr1 (101-192)||(45638577-45638668)
chr1 (104-218)||(48955714-48955826)
chr1 (104-160)||(49923762-49923818)
chr1 (170-218)||(51986308-51986356)
chr1 (181-220)||(3247313-3247352)
chr1 (105-219)||(4323829-4323943)
chr1 (181-220)||(8140549-8140588)
chr1 (104-159)||(10631473-10631528)
chr1 (104-159)||(13260266-13260321)
chr1 (181-220)||(24507689-24507728)
chr1 (181-220)||(24653917-24653956)
chr1 (181-220)||(33000420-33000459)
chr1 (181-220)||(38151058-38151097)
chr1 (181-220)||(38164141-38164180)
chr1 (181-220)||(40718225-40718264)
chr1 (104-159)||(45290457-45290512)
chr1 (181-220)||(45380482-45380521)
chr1 (181-220)||(47819442-47819481)
chr1 (107-192)||(3247474-3247559)
chr1 (99-192)||(16026850-16026943)
chr1 (102-160)||(16060829-16060887)
chr1 (107-218)||(18899842-18899949)
chr1 (102-160)||(20948753-20948811)
chr1 (106-160)||(26207280-26207334)
chr1 (99-192)||(26324859-26324952)
chr1 (105-159)||(32420099-32420153)
chr1 (173-219)||(32454176-32454222)
chr1 (173-219)||(32626779-32626825)
chr1 (173-219)||(37545695-37545741)
chr1 (107-192)||(38163934-38164019)
chr1 (99-192)||(40718386-40718479)
chr1 (103-160)||(3679930-3679987)
chr1 (173-218)||(7001650-7001695)
chr1 (104-217)||(11822250-11822365)
chr1 (181-218)||(15526206-15526243)
chr1 (173-218)||(16083286-16083331)
chr1 (102-155)||(17984650-17984703)
chr1 (100-219)||(26191355-26191472)
chr1 (103-156)||(26191682-26191735)
chr1 (104-192)||(31061063-31061151)
chr1 (104-216)||(32728938-32729049)
chr1 (107-195)||(32906149-32906237)
chr1 (104-219)||(33379888-33380001)
chr1 (170-219)||(34383113-34383162)
chr1 (103-160)||(34383188-34383245)
chr1 (104-192)||(39747474-39747561)
chr1 (104-192)||(44157954-44158042)
chr1 (102-159)||(46868522-46868579)
chr1 (104-160)||(1810927-1810983)
chr1 (104-219)||(12361011-12361125)
chr1 (104-160)||(13259988-13260044)
chr1 (104-204)||(15058667-15058766)
chr1 (104-160)||(18302331-18302387)
chr1 (181-217)||(19720828-19720864)
chr1 (102-216)||(29072749-29072864)
chr1 (104-160)||(32626529-32626585)
chr1 (104-160)||(33045355-33045411)
chr1 (104-160)||(33234546-33234602)
chr1 (104-160)||(45368490-45368546)
chr1 (104-160)||(48609538-48609594)
chr1 (105-205)||(3753214-3753310)
chr1 (104-159)||(12158690-12158745)
chr1 (105-156)||(15058419-15058470)
chr1 (181-216)||(16026693-16026728)
chr1 (102-153)||(22953507-22953558)
chr1 (104-214)||(26061956-26062066)
chr1 (105-160)||(27521577-27521632)
chr1 (181-220)||(30323044-30323083)
chr1 (181-220)||(31060902-31060941)
chr1 (181-220)||(33045567-33045606)
chr1 (104-151)||(34002635-34002682)
chr1 (104-213)||(35005634-35005744)
chr1 (181-220)||(35056645-35056684)
chr1 (105-160)||(39303675-39303730)
chr1 (181-216)||(39747684-39747719)
chr1 (104-159)||(41358369-41358424)
chr1 (105-218)||(44641079-44641190)
chr1 (106-192)||(46183686-46183772)
chr1 (103-219)||(1159726-1159840)
chr1 (107-192)||(7350648-7350733)
chr1 (106-152)||(17130035-17130081)
chr1 (173-215)||(17984405-17984447)
chr1 (104-158)||(18473541-18473595)
chr1 (107-219)||(18900021-18900130)
chr1 (173-219)||(20756087-20756133)
chr1 (103-215)||(24510196-24510309)
chr1 (101-159)||(24649347-24649405)
chr1 (173-219)||(26142488-26142534)
chr1 (173-219)||(26191611-26191657)
chr1 (110-218)||(32035442-32035541)
chr1 (99-145)||(32035747-32035793)
chr1 (173-219)||(32453996-32454042)
chr1 (102-160)||(41738794-41738852)
chr1 (173-219)||(45290706-45290752)
chr1 (102-160)||(52254423-52254481)
chr1 (104-215)||(3753463-3753572)
chr1 (104-201)||(4565240-4565336)
chr1 (107-200)||(7350426-7350518)
chr1 (175-220)||(7818885-7818930)
chr1 (173-214)||(10552204-10552245)
chr1 (181-214)||(15516792-15516825)
chr1 (104-192)||(16060596-16060683)
chr1 (173-218)||(31258589-31258634)
chr1 (107-160)||(34808200-34808253)
chr1 (1-103)||(3167384-3167483)
chr1 (104-160)||(3679626-3679682)
chr1 (104-156)||(11822004-11822056)
chr1 (104-156)||(22919925-22919977)
chr1 (19-103)||(23288635-23288719)
chr1 (104-160)||(32454238-32454294)
chr1 (103-159)||(37545627-37545683)
chr1 (104-160)||(50799130-50799186)
chr1 (173-216)||(292926-292969)
chr1 (104-159)||(990088-990143)
chr1 (170-205)||(1811069-1811104)
chr1 (170-205)||(2733351-2733386)
chr1 (170-205)||(3753378-3753413)
chr1 (105-160)||(5058736-5058790)
chr1 (104-159)||(8364861-8364916)
chr1 (170-205)||(10552111-10552146)
chr1 (181-220)||(10631279-10631318)
chr1 (170-205)||(12361178-12361213)
chr1 (170-205)||(13260153-13260188)
chr1 (170-205)||(14007654-14007689)
chr1 (170-205)||(17984494-17984529)
chr1 (170-205)||(18302181-18302216)
chr1 (170-205)||(18473439-18473474)
chr1 (105-160)||(19198893-19198948)
chr1 (170-205)||(19622823-19622858)
chr1 (104-159)||(19622962-19623017)
chr1 (170-205)||(20756186-20756221)
chr1 (181-216)||(20948855-20948890)
chr1 (170-205)||(21383269-21383304)
chr1 (104-155)||(22674203-22674254)
chr1 (170-205)||(26191525-26191560)
chr1 (170-205)||(26442698-26442733)
chr1 (104-159)||(30962416-30962471)
chr1 (173-216)||(32420343-32420386)
chr1 (170-205)||(32454088-32454123)
chr1 (170-205)||(32626691-32626726)
chr1 (170-205)||(33380054-33380089)
chr1 (104-159)||(35005444-35005499)
chr1 (170-205)||(35005552-35005587)
chr1 (170-205)||(37545750-37545785)
chr1 (170-205)||(39303794-39303829)
chr1 (170-205)||(41881261-41881296)
chr1 (104-151)||(42483224-42483271)
chr1 (170-205)||(45290624-45290659)
chr1 (104-159)||(45290765-45290820)
chr1 (181-220)||(46183900-46183939)
chr1 (170-205)||(46868394-46868429)
chr1 (170-205)||(48609393-48609428)
chr1 (170-205)||(50429008-50429043)
chr1 (170-205)||(52254348-52254383)
chr1 (170-205)||(52331568-52331603)
chr1 (173-215)||(2733252-2733294)
chr1 (175-205)||(4324001-4324031)
chr1 (117-159)||(10631413-10631455)
chr1 (181-219)||(11822212-11822250)
chr1 (102-156)||(12322602-12322656)
chr1 (177-219)||(14007761-14007803)
chr1 (173-219)||(15334985-15335031)
chr1 (173-219)||(16083120-16083166)
chr1 (106-160)||(17129691-17129745)
chr1 (126-160)||(18302075-18302109)
chr1 (173-219)||(21391263-21391309)
chr1 (170-204)||(24649517-24649551)
chr1 (117-159)||(26324832-26324874)
chr1 (173-215)||(29688322-29688364)
chr1 (104-158)||(29688374-29688428)
chr1 (181-219)||(31258549-31258587)
chr1 (107-145)||(31404429-31404467)
chr1 (176-218)||(33380144-33380186)
chr1 (181-219)||(49226445-49226483)
chr1 (181-218)||(1811025-1811062)
chr1 (173-218)||(3679874-3679919)
chr1 (107-152)||(4360299-4360343)
chr1 (104-192)||(12360603-12360691)
chr1 (181-218)||(12361220-12361257)
chr1 (181-218)||(13770698-13770735)
chr1 (173-214)||(17984587-17984628)
chr1 (106-206)||(29579322-29579422)
chr1 (181-218)||(35005594-35005631)
chr1 (181-218)||(35307864-35307901)
chr1 (107-156)||(39025112-39025161)
chr1 (181-214)||(42483088-42483121)
chr1 (181-218)||(45290666-45290703)
chr1 (173-218)||(45368558-45368603)
chr1 (173-218)||(49226485-49226530)
chr1 (104-160)||(4360570-4360626)
chr1 (104-160)||(4617339-4617395)
chr1 (19-103)||(4941710-4941794)
chr1 (177-217)||(10552033-10552073)
chr1 (181-217)||(13260194-13260230)
chr1 (103-159)||(15211803-15211859)
chr1 (104-160)||(17984333-17984389)
chr1 (181-217)||(17984451-17984487)
chr1 (104-160)||(18079398-18079454)
chr1 (23-59)||(21485968-21486004)
chr1 (186-218)||(22674388-22674420)
chr1 (108-160)||(24649604-24649656)
chr1 (107-159)||(31258647-31258699)
chr1 (104-156)||(33067348-33067400)
chr1 (181-217)||(48609349-48609385)
chr1 (104-156)||(52254183-52254235)
[»] chr8 (232 HSPs)
chr8 (104-220)||(2728232-2728348)
chr8 (98-220)||(35346882-35347004)
chr8 (104-217)||(10337119-10337232)
chr8 (99-220)||(35097323-35097444)
chr8 (104-220)||(32725907-32726023)
chr8 (102-220)||(34963548-34963666)
chr8 (104-220)||(7420474-7420590)
chr8 (104-220)||(20984394-20984510)
chr8 (104-220)||(28346394-28346510)
chr8 (104-220)||(37536086-37536202)
chr8 (104-218)||(9175012-9175126)
chr8 (104-216)||(9496341-9496453)
chr8 (104-211)||(8298868-8298975)
chr8 (104-216)||(3511906-3512018)
chr8 (99-215)||(5357418-5357534)
chr8 (104-220)||(10872915-10873031)
chr8 (107-219)||(28497504-28497616)
chr8 (104-220)||(11976373-11976488)
chr8 (103-220)||(7326304-7326422)
chr8 (104-220)||(25600480-25600597)
chr8 (104-220)||(25702512-25702628)
chr8 (105-216)||(24090376-24090487)
chr8 (105-207)||(15930933-15931035)
chr8 (104-214)||(10540670-10540782)
chr8 (106-219)||(13779151-13779264)
chr8 (102-194)||(42133064-42133156)
chr8 (107-218)||(14848076-14848186)
chr8 (104-215)||(20277946-20278057)
chr8 (104-215)||(21064573-21064684)
chr8 (103-192)||(8298586-8298675)
chr8 (104-218)||(17073807-17073918)
chr8 (104-218)||(17574352-17574463)
chr8 (104-200)||(4710124-4710220)
chr8 (104-216)||(6469280-6469392)
chr8 (107-215)||(13796485-13796593)
chr8 (99-218)||(29487745-29487862)
chr8 (104-219)||(8094479-8094594)
chr8 (104-216)||(9832215-9832326)
chr8 (102-219)||(14488961-14489075)
chr8 (104-215)||(27341480-27341591)
chr8 (100-159)||(1778560-1778619)
chr8 (104-218)||(7272420-7272534)
chr8 (104-218)||(13155137-13155251)
chr8 (104-218)||(16643930-16644044)
chr8 (104-219)||(22650464-22650581)
chr8 (102-160)||(7185948-7186006)
chr8 (103-220)||(13232447-13232563)
chr8 (103-192)||(35346628-35346717)
chr8 (104-192)||(3512178-3512266)
chr8 (102-159)||(10873225-10873282)
chr8 (104-192)||(11019520-11019608)
chr8 (104-192)||(20984146-20984234)
chr8 (104-218)||(28398926-28399035)
chr8 (117-220)||(1778813-1778916)
chr8 (104-219)||(28323849-28323963)
chr8 (104-160)||(28324125-28324181)
chr8 (104-215)||(29158354-29158465)
chr8 (107-214)||(33652193-33652300)
chr8 (104-219)||(38930549-38930664)
chr8 (104-219)||(40492960-40493067)
chr8 (102-219)||(40844154-40844268)
chr8 (102-192)||(2728509-2728599)
chr8 (103-219)||(4375691-4375804)
chr8 (105-219)||(6146834-6146948)
chr8 (104-159)||(7420230-7420285)
chr8 (104-159)||(24187842-24187897)
chr8 (104-216)||(33526303-33526412)
chr8 (102-192)||(35097604-35097694)
chr8 (101-218)||(10776145-10776261)
chr8 (107-192)||(11976648-11976733)
chr8 (107-192)||(13232201-13232286)
chr8 (98-219)||(19494113-19494233)
chr8 (100-216)||(10776387-10776503)
chr8 (104-192)||(11019769-11019857)
chr8 (170-219)||(14495184-14495233)
chr8 (104-192)||(28346670-28346758)
chr8 (104-192)||(32726183-32726271)
chr8 (99-219)||(33636317-33636437)
chr8 (104-192)||(34963300-34963388)
chr8 (102-159)||(42132862-42132919)
chr8 (104-219)||(1525809-1525924)
chr8 (104-160)||(6469611-6469667)
chr8 (104-160)||(14238751-14238807)
chr8 (104-160)||(25600230-25600286)
chr8 (104-200)||(27117753-27117848)
chr8 (104-219)||(38930302-38930416)
chr8 (102-215)||(40066712-40066822)
chr8 (181-220)||(1778775-1778814)
chr8 (109-218)||(3680532-3680642)
chr8 (104-159)||(4473704-4473759)
chr8 (181-220)||(4473915-4473954)
chr8 (181-220)||(11976487-11976526)
chr8 (104-218)||(14238967-14239080)
chr8 (104-206)||(16643661-16643762)
chr8 (181-220)||(28346509-28346548)
chr8 (181-220)||(32726022-32726061)
chr8 (181-220)||(34963510-34963549)
chr8 (181-220)||(35097443-35097482)
chr8 (102-192)||(37536331-37536421)
chr8 (104-194)||(44997931-44998021)
chr8 (102-192)||(44998176-44998265)
chr8 (181-219)||(3512018-3512056)
chr8 (103-192)||(4621266-4621355)
chr8 (104-158)||(10540449-10540503)
chr8 (106-160)||(18549517-18549571)
chr8 (100-154)||(23939543-23939597)
chr8 (173-215)||(32195348-32195390)
chr8 (173-219)||(33636571-33636617)
chr8 (182-220)||(37536201-37536239)
chr8 (102-198)||(7272657-7272753)
chr8 (104-192)||(7326086-7326174)
chr8 (104-192)||(9496635-9496723)
chr8 (104-192)||(10337361-10337449)
chr8 (104-216)||(14495069-14495180)
chr8 (103-160)||(16789313-16789370)
chr8 (104-192)||(24814980-24815068)
chr8 (107-218)||(29991918-29992027)
chr8 (104-219)||(32418318-32418431)
chr8 (103-219)||(33526051-33526167)
chr8 (104-192)||(42430032-42430120)
chr8 (104-160)||(4473988-4474044)
chr8 (105-192)||(5357675-5357762)
chr8 (170-218)||(6146733-6146781)
chr8 (104-152)||(15719931-15719979)
chr8 (104-160)||(16789075-16789131)
chr8 (104-160)||(20277692-20277748)
chr8 (104-160)||(21064319-21064375)
chr8 (175-219)||(21509765-21509809)
chr8 (104-160)||(25131111-25131167)
chr8 (104-156)||(28497255-28497307)
chr8 (104-160)||(32040075-32040131)
chr8 (104-218)||(42429758-42429869)
chr8 (104-160)||(43477163-43477219)
chr8 (104-159)||(1526117-1526172)
chr8 (181-216)||(2811652-2811687)
chr8 (104-159)||(3680746-3680801)
chr8 (172-219)||(6146684-6146731)
chr8 (181-220)||(8298798-8298837)
chr8 (181-220)||(10873030-10873069)
chr8 (181-220)||(13232409-13232448)
chr8 (102-157)||(15719654-15719709)
chr8 (104-159)||(19494358-19494413)
chr8 (181-220)||(20984356-20984395)
chr8 (104-159)||(22917564-22917619)
chr8 (173-219)||(1163160-1163206)
chr8 (173-219)||(6146583-6146629)
chr8 (107-192)||(9175283-9175368)
chr8 (181-215)||(9496479-9496513)
chr8 (181-219)||(11019730-11019768)
chr8 (173-219)||(22917813-22917859)
chr8 (104-158)||(24954956-24955010)
chr8 (182-220)||(25600443-25600481)
chr8 (170-216)||(29158522-29158568)
chr8 (173-219)||(30336990-30337036)
chr8 (173-215)||(32040263-32040305)
chr8 (174-219)||(4016972-4017017)
chr8 (104-192)||(13154886-13154974)
chr8 (104-219)||(19962995-19963111)
chr8 (173-214)||(23939802-23939843)
chr8 (107-160)||(40844479-40844532)
chr8 (181-220)||(2728347-2728387)
chr8 (107-155)||(2811730-2811778)
chr8 (19-103)||(5725856-5725940)
chr8 (181-213)||(7420441-7420473)
chr8 (102-158)||(25131393-25131449)
chr8 (104-156)||(28258189-28258241)
chr8 (19-103)||(28430049-28430133)
chr8 (104-160)||(29488054-29488110)
chr8 (181-213)||(35346839-35346871)
chr8 (170-205)||(1686492-1686527)
chr8 (104-159)||(4017245-4017300)
chr8 (170-205)||(7272588-7272623)
chr8 (170-205)||(10755329-10755364)
chr8 (105-160)||(13779476-13779531)
chr8 (170-205)||(14488882-14488917)
chr8 (107-158)||(14847828-14847879)
chr8 (170-205)||(15719823-15719858)
chr8 (170-205)||(18549371-18549406)
chr8 (170-205)||(24187734-24187769)
chr8 (170-205)||(24954809-24954844)
chr8 (170-205)||(27341388-27341423)
chr8 (170-205)||(28398837-28398872)
chr8 (170-205)||(29487909-29487944)
chr8 (170-205)||(30337089-30337124)
chr8 (105-160)||(30969399-30969454)
chr8 (170-205)||(32418477-32418512)
chr8 (170-205)||(33636490-33636525)
chr8 (105-152)||(36044744-36044791)
chr8 (173-218)||(1408072-1408115)
chr8 (173-215)||(1408244-1408286)
chr8 (170-204)||(3068953-3068987)
chr8 (105-159)||(4016906-4016960)
chr8 (127-192)||(4709929-4709994)
chr8 (173-215)||(7578421-7578463)
chr8 (175-205)||(8094652-8094682)
chr8 (182-216)||(8298830-8298864)
chr8 (173-219)||(14488783-14488829)
chr8 (173-219)||(14496881-14496927)
chr8 (173-219)||(22917634-22917680)
chr8 (175-205)||(22917725-22917755)
chr8 (117-159)||(23939620-23939662)
chr8 (181-219)||(25131318-25131356)
chr8 (181-211)||(25702629-25702659)
chr8 (104-158)||(27117922-27117976)
chr8 (102-156)||(29158617-29158671)
chr8 (181-219)||(30337131-30337169)
chr8 (185-219)||(32195529-32195563)
chr8 (181-219)||(40844289-40844327)
chr8 (177-219)||(43477399-43477441)
chr8 (170-204)||(43727229-43727263)
chr8 (106-156)||(43727382-43727431)
chr8 (170-212)||(44849543-44849585)
chr8 (175-220)||(1408137-1408182)
chr8 (173-218)||(1526059-1526104)
chr8 (107-156)||(1685117-1685166)
chr8 (107-160)||(2356192-2356245)
chr8 (181-218)||(4375899-4375936)
chr8 (104-157)||(8094788-8094841)
chr8 (111-156)||(23360378-23360423)
chr8 (181-214)||(23360582-23360615)
chr8 (181-218)||(38930511-38930548)
chr8 (103-159)||(1162908-1162964)
chr8 (181-217)||(14488924-14488960)
chr8 (107-155)||(17574105-17574153)
chr8 (104-160)||(18549201-18549257)
chr8 (104-160)||(21125719-21125775)
chr8 (104-160)||(24187569-24187625)
chr8 (104-160)||(29992244-29992300)
chr8 (107-155)||(35115382-35115430)
chr8 (104-160)||(35345561-35345617)
chr8 (104-136)||(39439924-39439956)
chr8 (104-160)||(40066497-40066553)
[»] chr5 (238 HSPs)
chr5 (104-220)||(1381247-1381363)
chr5 (101-217)||(35928345-35928461)
chr5 (104-220)||(5917126-5917242)
chr5 (104-220)||(19565467-19565583)
chr5 (104-220)||(18258411-18258527)
chr5 (104-220)||(35876936-35877052)
chr5 (102-218)||(40038744-40038860)
chr5 (104-220)||(37271359-37271476)
chr5 (104-220)||(19685264-19685380)
chr5 (104-220)||(20985973-20986089)
chr5 (104-220)||(24443628-24443744)
chr5 (106-217)||(6912744-6912855)
chr5 (104-219)||(30888160-30888275)
chr5 (104-218)||(36973596-36973710)
chr5 (104-218)||(40764666-40764780)
chr5 (103-220)||(45137-45254)
chr5 (105-218)||(2636880-2636992)
chr5 (106-219)||(20690981-20691094)
chr5 (1-103)||(41732282-41732381)
chr5 (104-218)||(5904008-5904122)
chr5 (104-219)||(30800737-30800850)
chr5 (102-218)||(20661199-20661313)
chr5 (107-204)||(26071517-26071613)
chr5 (101-218)||(42596704-42596820)
chr5 (102-218)||(42553894-42554010)
chr5 (104-219)||(5614415-5614530)
chr5 (104-205)||(29692744-29692845)
chr5 (104-219)||(36577722-36577834)
chr5 (104-196)||(5917368-5917460)
chr5 (107-220)||(28108048-28108159)
chr5 (100-192)||(36973349-36973441)
chr5 (103-160)||(42553641-42553698)
chr5 (104-219)||(2217494-2217609)
chr5 (170-218)||(4736286-4736334)
chr5 (106-158)||(27850320-27850372)
chr5 (104-219)||(29172772-29172886)
chr5 (104-194)||(1104858-1104948)
chr5 (104-218)||(1286682-1286796)
chr5 (104-218)||(5614166-5614280)
chr5 (104-159)||(19685017-19685072)
chr5 (105-219)||(27916462-27916576)
chr5 (102-219)||(28863720-28863840)
chr5 (100-219)||(29366835-29366953)
chr5 (106-215)||(16038629-16038738)
chr5 (102-219)||(18633846-18633963)
chr5 (102-218)||(28550825-28550939)
chr5 (104-192)||(1105060-1105148)
chr5 (104-192)||(1381523-1381611)
chr5 (104-192)||(4736454-4736542)
chr5 (107-219)||(15635379-15635490)
chr5 (104-192)||(19565743-19565831)
chr5 (99-160)||(20690728-20690789)
chr5 (104-204)||(24781989-24782089)
chr5 (104-219)||(28863510-28863622)
chr5 (170-219)||(34125472-34125521)
chr5 (104-192)||(35928064-35928152)
chr5 (104-192)||(37271618-37271706)
chr5 (104-188)||(38170514-38170598)
chr5 (104-192)||(40764415-40764503)
chr5 (104-219)||(42207242-42207355)
chr5 (103-159)||(6912496-6912552)
chr5 (104-219)||(18633599-18633713)
chr5 (104-160)||(26133357-26133413)
chr5 (100-160)||(33335970-33336030)
chr5 (104-218)||(36577972-36578083)
chr5 (181-220)||(1381362-1381401)
chr5 (102-192)||(2636667-2636757)
chr5 (104-215)||(5950176-5950283)
chr5 (181-220)||(19565582-19565621)
chr5 (181-220)||(19685226-19685265)
chr5 (102-192)||(20985723-20985813)
chr5 (105-219)||(29172524-29172638)
chr5 (104-218)||(29875400-29875513)
chr5 (181-220)||(35876898-35876937)
chr5 (181-220)||(35928274-35928313)
chr5 (104-218)||(38496669-38496782)
chr5 (104-218)||(38554751-38554862)
chr5 (173-219)||(6118380-6118426)
chr5 (104-216)||(7075572-7075682)
chr5 (104-219)||(14318045-14318157)
chr5 (103-218)||(21050802-21050914)
chr5 (102-219)||(29151514-29151631)
chr5 (104-219)||(29692978-29693090)
chr5 (104-219)||(30800494-30800604)
chr5 (173-219)||(39379495-39379541)
chr5 (104-217)||(40167896-40168008)
chr5 (100-156)||(9588559-9588616)
chr5 (104-219)||(10743941-10744054)
chr5 (173-218)||(15635594-15635639)
chr5 (99-156)||(23382245-23382302)
chr5 (104-192)||(24443380-24443468)
chr5 (106-218)||(35609523-35609635)
chr5 (104-192)||(35876688-35876776)
chr5 (104-215)||(38786159-38786268)
chr5 (103-160)||(40029441-40029498)
chr5 (170-218)||(3850412-3850460)
chr5 (104-160)||(4203714-4203770)
chr5 (104-160)||(10830529-10830585)
chr5 (102-158)||(15916284-15916340)
chr5 (104-215)||(16038377-16038487)
chr5 (104-160)||(18046038-18046094)
chr5 (104-156)||(20660948-20661000)
chr5 (104-160)||(21124913-21124969)
chr5 (104-160)||(23381950-23382006)
chr5 (175-219)||(23382195-23382239)
chr5 (107-159)||(39379242-39379294)
chr5 (181-220)||(45253-45292)
chr5 (104-159)||(3850544-3850599)
chr5 (104-159)||(11799129-11799184)
chr5 (104-159)||(18258162-18258217)
chr5 (181-220)||(18258373-18258412)
chr5 (181-220)||(20985935-20985974)
chr5 (173-216)||(21050642-21050685)
chr5 (105-160)||(22551263-22551318)
chr5 (181-216)||(24443590-24443625)
chr5 (104-159)||(29875670-29875725)
chr5 (104-194)||(32109007-32109096)
chr5 (176-219)||(35166045-35166088)
chr5 (104-159)||(35167110-35167165)
chr5 (104-158)||(2217800-2217854)
chr5 (173-219)||(7075847-7075893)
chr5 (173-219)||(10409000-10409046)
chr5 (99-204)||(12144902-12145006)
chr5 (170-216)||(21125060-21125106)
chr5 (173-215)||(24782166-24782208)
chr5 (103-212)||(25561704-25561813)
chr5 (104-214)||(28871886-28871994)
chr5 (104-150)||(38182041-38182087)
chr5 (104-150)||(38189044-38189090)
chr5 (104-150)||(38209267-38209313)
chr5 (104-150)||(38216269-38216315)
chr5 (173-215)||(38496488-38496530)
chr5 (174-216)||(42207477-42207519)
chr5 (102-159)||(6118444-6118501)
chr5 (173-218)||(9532420-9532465)
chr5 (173-218)||(10409212-10409257)
chr5 (104-156)||(10830844-10830897)
chr5 (105-158)||(11935914-11935967)
chr5 (170-219)||(15635543-15635592)
chr5 (181-218)||(17070746-17070783)
chr5 (103-160)||(26133182-26133239)
chr5 (104-192)||(28213373-28213461)
chr5 (107-160)||(28871640-28871693)
chr5 (108-192)||(32888691-32888775)
chr5 (104-153)||(35166911-35166960)
chr5 (103-160)||(35609302-35609359)
chr5 (4-103)||(37941263-37941359)
chr5 (104-218)||(40029141-40029252)
chr5 (95-160)||(40167777-40167842)
chr5 (181-218)||(40764625-40764662)
chr5 (104-156)||(2032888-2032940)
chr5 (104-148)||(4736205-4736249)
chr5 (104-156)||(10743724-10743776)
chr5 (174-218)||(10743793-10743837)
chr5 (104-160)||(11799402-11799458)
chr5 (104-160)||(17070535-17070590)
chr5 (104-156)||(18046296-18046348)
chr5 (104-160)||(20683747-20683803)
chr5 (104-160)||(26071291-26071347)
chr5 (104-152)||(31037693-31037741)
chr5 (104-160)||(32108808-32108864)
chr5 (188-220)||(35928312-35928344)
chr5 (102-154)||(38962804-38962856)
chr5 (104-160)||(42596453-42596509)
chr5 (170-205)||(3850622-3850657)
chr5 (103-154)||(5103951-5104002)
chr5 (170-205)||(6118292-6118327)
chr5 (181-216)||(6912708-6912743)
chr5 (170-205)||(7075759-7075794)
chr5 (104-159)||(10408928-10408983)
chr5 (104-159)||(15635652-15635707)
chr5 (170-205)||(16038537-16038572)
chr5 (170-205)||(18633758-18633793)
chr5 (170-205)||(25561875-25561910)
chr5 (170-205)||(27850174-27850209)
chr5 (170-205)||(28550993-28551028)
chr5 (170-205)||(29151684-29151719)
chr5 (170-205)||(29692890-29692925)
chr5 (105-160)||(29855614-29855669)
chr5 (183-218)||(29855820-29855855)
chr5 (170-205)||(31155503-31155538)
chr5 (170-205)||(33335822-33335857)
chr5 (173-216)||(33335913-33335956)
chr5 (104-159)||(35166103-35166158)
chr5 (170-205)||(36577887-36577922)
chr5 (170-205)||(38786324-38786359)
chr5 (170-205)||(39761475-39761510)
chr5 (175-205)||(293990-294020)
chr5 (175-205)||(2217655-2217685)
chr5 (104-154)||(4203456-4203506)
chr5 (181-219)||(5614282-5614320)
chr5 (175-205)||(9179720-9179750)
chr5 (101-151)||(12145136-12145186)
chr5 (173-219)||(14318287-14318333)
chr5 (107-157)||(20417963-20418013)
chr5 (175-205)||(25778959-25778989)
chr5 (173-219)||(25779047-25779093)
chr5 (117-159)||(28871711-28871753)
chr5 (175-205)||(29875572-29875602)
chr5 (175-205)||(30800649-30800679)
chr5 (173-215)||(31037464-31037506)
chr5 (175-205)||(31037568-31037598)
chr5 (174-216)||(31155440-31155482)
chr5 (117-155)||(31602221-31602259)
chr5 (173-219)||(37090455-37090501)
chr5 (106-152)||(38452348-38452394)
chr5 (175-205)||(38496592-38496622)
chr5 (174-219)||(40167853-40167896)
chr5 (107-152)||(45456-45501)
chr5 (107-160)||(1286989-1287042)
chr5 (181-218)||(6118248-6118285)
chr5 (177-218)||(9179665-9179706)
chr5 (175-216)||(13990676-13990717)
chr5 (107-152)||(18286431-18286476)
chr5 (104-157)||(20416360-20416413)
chr5 (187-220)||(28108016-28108049)
chr5 (66-103)||(28440843-28440880)
chr5 (181-218)||(29172733-29172770)
chr5 (175-212)||(31602404-31602441)
chr5 (181-218)||(36577934-36577971)
chr5 (181-218)||(39379437-39379474)
chr5 (104-156)||(293828-293880)
chr5 (173-205)||(3850724-3850756)
chr5 (104-160)||(3851273-3851329)
chr5 (104-160)||(9179593-9179649)
chr5 (104-160)||(9179864-9179920)
chr5 (174-214)||(9532259-9532299)
chr5 (104-156)||(13990843-13990895)
chr5 (104-160)||(17070807-17070863)
chr5 (104-160)||(21050575-21050631)
chr5 (104-152)||(25561951-25561999)
chr5 (104-160)||(30888375-30888431)
chr5 (183-219)||(31037607-31037643)
chr5 (177-205)||(31156079-31156107)
chr5 (117-157)||(32888760-32888800)
chr5 (104-156)||(34125307-34125359)
chr5 (104-160)||(34125576-34125632)
chr5 (104-156)||(39379558-39379610)
[»] chr4 (293 HSPs)
chr4 (104-220)||(35464018-35464134)
chr4 (104-218)||(13631228-13631342)
chr4 (103-220)||(31560579-31560696)
chr4 (104-220)||(13530597-13530713)
chr4 (104-218)||(43231275-43231389)
chr4 (104-220)||(29499182-29499298)
chr4 (104-220)||(30046676-30046792)
chr4 (104-220)||(30061017-30061133)
chr4 (99-218)||(53915933-53916052)
chr4 (102-219)||(5797479-5797595)
chr4 (106-218)||(19903541-19903653)
chr4 (104-220)||(23245479-23245595)
chr4 (104-220)||(42848027-42848143)
chr4 (104-211)||(25423924-25424031)
chr4 (101-216)||(46115411-46115526)
chr4 (101-216)||(46128545-46128660)
chr4 (104-218)||(14487802-14487916)
chr4 (104-220)||(24774045-24774161)
chr4 (104-220)||(51762870-51762986)
chr4 (104-219)||(23779110-23779225)
chr4 (107-218)||(50753925-50754036)
chr4 (104-220)||(26412190-26412307)
chr4 (107-216)||(47022743-47022852)
chr4 (109-221)||(47532555-47532667)
chr4 (104-219)||(13074010-13074125)
chr4 (99-216)||(20291981-20292098)
chr4 (106-218)||(35420588-35420701)
chr4 (106-218)||(30564835-30564947)
chr4 (102-218)||(35415519-35415635)
chr4 (104-200)||(42823776-42823872)
chr4 (105-220)||(47136055-47136170)
chr4 (104-211)||(51738137-51738244)
chr4 (99-218)||(11693009-11693126)
chr4 (104-218)||(13764693-13764807)
chr4 (104-218)||(35763841-35763955)
chr4 (101-194)||(19321769-19321862)
chr4 (104-218)||(44925485-44925598)
chr4 (103-219)||(4279220-4279336)
chr4 (104-192)||(25424224-25424312)
chr4 (103-200)||(53307973-53308069)
chr4 (104-219)||(6827759-6827874)
chr4 (104-219)||(36702000-36702114)
chr4 (104-219)||(52017755-52017870)
chr4 (104-218)||(9289266-9289380)
chr4 (106-218)||(9445951-9446060)
chr4 (104-215)||(29420427-29420537)
chr4 (102-160)||(13073757-13073815)
chr4 (105-205)||(2322094-2322194)
chr4 (104-219)||(9446210-9446323)
chr4 (104-192)||(14488099-14488187)
chr4 (103-219)||(22099542-22099658)
chr4 (102-159)||(25358485-25358542)
chr4 (104-216)||(35119499-35119611)
chr4 (104-192)||(43231088-43231176)
chr4 (103-219)||(50714451-50714566)
chr4 (104-160)||(7642596-7642652)
chr4 (107-218)||(41619902-41620013)
chr4 (104-218)||(45593474-45593586)
chr4 (104-159)||(14791751-14791806)
chr4 (102-192)||(23245229-23245319)
chr4 (102-192)||(26412496-26412586)
chr4 (102-192)||(35464294-35464384)
chr4 (173-219)||(5203000-5203046)
chr4 (102-160)||(5827653-5827711)
chr4 (104-219)||(16712579-16712691)
chr4 (107-219)||(38054549-38054659)
chr4 (102-160)||(41324834-41324892)
chr4 (102-156)||(42824039-42824093)
chr4 (103-192)||(42848303-42848392)
chr4 (104-192)||(2322344-2322432)
chr4 (104-192)||(12152405-12152493)
chr4 (173-218)||(12791678-12791723)
chr4 (96-192)||(13530371-13530467)
chr4 (104-192)||(13631511-13631599)
chr4 (104-218)||(52429989-52430100)
chr4 (104-160)||(5827917-5827973)
chr4 (105-218)||(7639897-7640007)
chr4 (104-160)||(12791918-12791974)
chr4 (104-160)||(13479555-13479611)
chr4 (104-160)||(13764613-13764669)
chr4 (106-212)||(18831072-18831176)
chr4 (104-219)||(29463799-29463913)
chr4 (104-160)||(31812157-31812213)
chr4 (104-160)||(45505600-45505656)
chr4 (104-156)||(53716921-53716973)
chr4 (103-218)||(53717060-53717175)
chr4 (102-219)||(55482356-55482470)
chr4 (109-160)||(2034544-2034595)
chr4 (105-160)||(11285504-11285559)
chr4 (181-220)||(13631350-13631389)
chr4 (104-216)||(22584499-22584607)
chr4 (181-220)||(29499297-29499336)
chr4 (181-220)||(30046638-30046677)
chr4 (181-220)||(30060979-30061018)
chr4 (181-220)||(31560541-31560580)
chr4 (181-220)||(35464133-35464172)
chr4 (105-160)||(36050289-36050344)
chr4 (105-219)||(36702248-36702362)
chr4 (105-160)||(44925789-44925844)
chr4 (104-159)||(46088005-46088060)
chr4 (181-220)||(46115529-46115568)
chr4 (181-220)||(46128663-46128702)
chr4 (104-209)||(46292545-46292651)
chr4 (99-215)||(52441758-52441870)
chr4 (126-220)||(54208483-54208577)
chr4 (104-219)||(5882552-5882663)
chr4 (104-219)||(13064159-13064271)
chr4 (104-218)||(20144618-20144731)
chr4 (173-219)||(23779032-23779078)
chr4 (104-158)||(24474909-24474963)
chr4 (107-192)||(29499458-29499543)
chr4 (104-213)||(31182396-31182504)
chr4 (173-219)||(35415368-35415414)
chr4 (173-219)||(41620141-41620187)
chr4 (173-219)||(41920970-41921016)
chr4 (173-219)||(46087827-46087873)
chr4 (107-192)||(47135781-47135866)
chr4 (173-219)||(50822179-50822225)
chr4 (173-219)||(51708913-51708959)
chr4 (181-219)||(53915893-53915931)
chr4 (173-218)||(6827615-6827660)
chr4 (105-219)||(13479273-13479384)
chr4 (107-218)||(14791502-14791614)
chr4 (104-215)||(18205156-18205265)
chr4 (104-192)||(19321570-19321658)
chr4 (181-218)||(26412337-26412374)
chr4 (170-215)||(28448897-28448942)
chr4 (173-218)||(31370919-31370964)
chr4 (104-192)||(46115691-46115779)
chr4 (104-192)||(46128825-46128913)
chr4 (104-192)||(53915683-53915771)
chr4 (107-160)||(54208769-54208822)
chr4 (170-218)||(8904936-8904984)
chr4 (104-160)||(13064409-13064465)
chr4 (104-160)||(22099856-22099912)
chr4 (67-103)||(25505313-25505349)
chr4 (104-160)||(26314276-26314332)
chr4 (109-215)||(27008297-27008401)
chr4 (104-156)||(29380858-29380910)
chr4 (104-160)||(31811925-31811981)
chr4 (104-219)||(32365094-32365208)
chr4 (104-160)||(32365427-32365483)
chr4 (104-156)||(34361803-34361855)
chr4 (104-211)||(41345853-41345960)
chr4 (175-219)||(45505676-45505720)
chr4 (103-159)||(46292391-46292447)
chr4 (170-218)||(50714350-50714398)
chr4 (104-160)||(52017505-52017561)
chr4 (104-160)||(52442036-52442092)
chr4 (104-160)||(54903419-54903475)
chr4 (104-219)||(55072389-55072504)
chr4 (104-159)||(4211561-4211616)
chr4 (105-160)||(6353582-6353637)
chr4 (105-160)||(8191076-8191131)
chr4 (104-159)||(9289584-9289639)
chr4 (181-220)||(24774177-24774216)
chr4 (170-213)||(25358286-25358329)
chr4 (181-220)||(25424062-25424101)
chr4 (175-218)||(27008153-27008196)
chr4 (104-219)||(32208542-32208655)
chr4 (104-159)||(35763647-35763702)
chr4 (176-219)||(41346104-41346147)
chr4 (104-159)||(47023050-47023105)
chr4 (173-219)||(5063249-5063295)
chr4 (107-192)||(5797732-5797817)
chr4 (173-219)||(16712400-16712446)
chr4 (106-160)||(18205467-18205521)
chr4 (102-160)||(26313986-26314044)
chr4 (177-219)||(27427915-27427957)
chr4 (102-160)||(28809009-28809067)
chr4 (107-192)||(30060772-30060857)
chr4 (91-192)||(31560318-31560419)
chr4 (106-160)||(35420393-35420447)
chr4 (106-160)||(43368467-43368521)
chr4 (106-160)||(51830891-51830945)
chr4 (173-215)||(55482173-55482215)
chr4 (99-219)||(123529-123648)
chr4 (181-218)||(9289472-9289509)
chr4 (103-160)||(27008083-27008140)
chr4 (174-219)||(32208789-32208834)
chr4 (104-219)||(45505778-45505894)
chr4 (102-159)||(50714238-50714295)
chr4 (107-160)||(51545913-51545966)
chr4 (104-160)||(2034799-2034855)
chr4 (104-160)||(2180220-2180276)
chr4 (104-160)||(4279022-4279078)
chr4 (181-217)||(5203046-5203082)
chr4 (125-192)||(5203205-5203272)
chr4 (104-160)||(8760604-8760660)
chr4 (104-160)||(8760725-8760781)
chr4 (104-160)||(12152154-12152210)
chr4 (181-217)||(14487940-14487976)
chr4 (104-156)||(14594206-14594258)
chr4 (108-160)||(14594509-14594561)
chr4 (107-159)||(15555506-15555558)
chr4 (176-216)||(18135856-18135896)
chr4 (104-160)||(22584287-22584343)
chr4 (19-103)||(27572550-27572634)
chr4 (104-160)||(35119292-35119348)
chr4 (104-160)||(36054094-36054150)
chr4 (170-206)||(37556909-37556945)
chr4 (105-192)||(37557107-37557194)
chr4 (104-156)||(41346166-41346218)
chr4 (99-135)||(41933813-41933849)
chr4 (182-214)||(46292513-46292545)
chr4 (176-216)||(49123064-49123104)
chr4 (104-152)||(52543422-52543470)
chr4 (170-218)||(54903177-54903225)
chr4 (170-205)||(2180371-2180406)
chr4 (176-219)||(2180459-2180502)
chr4 (170-205)||(4279132-4279167)
chr4 (100-158)||(5202922-5202981)
chr4 (170-205)||(6827671-6827706)
chr4 (52-103)||(9363276-9363327)
chr4 (170-205)||(9446122-9446157)
chr4 (170-205)||(11285670-11285705)
chr4 (170-205)||(13479437-13479472)
chr4 (170-205)||(18205322-18205357)
chr4 (170-205)||(20878872-20878907)
chr4 (181-220)||(23245441-23245480)
chr4 (28-103)||(23464244-23464319)
chr4 (173-216)||(24474669-24474712)
chr4 (170-205)||(27428010-27428045)
chr4 (183-218)||(28448979-28449014)
chr4 (183-214)||(28449117-28449148)
chr4 (104-159)||(29380668-29380723)
chr4 (170-205)||(32208708-32208743)
chr4 (170-205)||(38054712-38054747)
chr4 (170-205)||(41316078-41316113)
chr4 (182-217)||(41439999-41440034)
chr4 (170-205)||(41920882-41920917)
chr4 (170-205)||(42306083-42306118)
chr4 (181-220)||(42848142-42848181)
chr4 (170-205)||(45593392-45593427)
chr4 (170-205)||(46087924-46087959)
chr4 (173-216)||(51545696-51545739)
chr4 (104-155)||(51708693-51708744)
chr4 (170-205)||(51708825-51708860)
chr4 (181-220)||(54208576-54208615)
chr4 (170-205)||(55893390-55893425)
chr4 (176-218)||(123781-123823)
chr4 (177-219)||(3178755-3178797)
chr4 (102-160)||(8191335-8191393)
chr4 (175-205)||(9289435-9289465)
chr4 (182-212)||(13530560-13530590)
chr4 (105-155)||(15555587-15555637)
chr4 (173-215)||(18830913-18830955)
chr4 (99-192)||(19903256-19903349)
chr4 (117-159)||(20144492-20144534)
chr4 (181-219)||(22099665-22099703)
chr4 (175-205)||(23254538-23254568)
chr4 (104-154)||(23778964-23779014)
chr4 (182-216)||(25424035-25424069)
chr4 (190-220)||(26412306-26412336)
chr4 (104-158)||(28809126-28809180)
chr4 (181-219)||(41345972-41346010)
chr4 (181-219)||(42306125-42306163)
chr4 (101-135)||(44705296-44705330)
chr4 (117-159)||(50754140-50754182)
chr4 (170-220)||(50822081-50822131)
chr4 (170-220)||(55482253-55482303)
chr4 (103-192)||(55805000-55805089)
chr4 (173-214)||(5052476-5052517)
chr4 (181-218)||(13479479-13479516)
chr4 (117-158)||(14594453-14594494)
chr4 (181-218)||(16712447-16712484)
chr4 (107-160)||(20144423-20144476)
chr4 (102-159)||(22204053-22204110)
chr4 (181-218)||(23254494-23254531)
chr4 (181-214)||(31182335-31182368)
chr4 (173-218)||(32365371-32365416)
chr4 (99-160)||(34355227-34355288)
chr4 (181-218)||(34361899-34361936)
chr4 (191-220)||(47532521-47532550)
chr4 (181-218)||(51708781-51708818)
chr4 (181-218)||(52429921-52429958)
chr4 (117-158)||(54903362-54903403)
chr4 (107-160)||(55072656-55072709)
chr4 (117-157)||(2034741-2034781)
chr4 (170-206)||(4211748-4211783)
chr4 (104-156)||(5052532-5052584)
chr4 (104-152)||(8904886-8904934)
chr4 (173-201)||(9289543-9289571)
chr4 (176-216)||(11285754-11285794)
chr4 (104-160)||(18136057-18136113)
chr4 (1-103)||(22851249-22851348)
chr4 (104-152)||(28449166-28449214)
chr4 (177-213)||(36050482-36050518)
chr4 (104-156)||(41921032-41921084)
chr4 (175-219)||(45593296-45593340)
chr4 (102-154)||(47274180-47274232)
chr4 (104-160)||(49123265-49123321)
chr4 (104-160)||(51545629-51545685)
[»] chr2 (244 HSPs)
chr2 (104-220)||(25705085-25705201)
chr2 (103-220)||(146574-146691)
chr2 (104-220)||(29859756-29859872)
chr2 (104-218)||(43672204-43672318)
chr2 (103-220)||(20131565-20131682)
chr2 (104-220)||(14003626-14003742)
chr2 (104-220)||(15842707-15842823)
chr2 (104-220)||(24358616-24358732)
chr2 (104-218)||(13215060-13215174)
chr2 (104-218)||(33575752-33575866)
chr2 (104-219)||(1138244-1138359)
chr2 (104-218)||(40125175-40125289)
chr2 (104-220)||(30215754-30215871)
chr2 (104-220)||(2481441-2481557)
chr2 (104-218)||(16523211-16523325)
chr2 (99-219)||(11788302-11788421)
chr2 (99-220)||(18113338-18113459)
chr2 (105-218)||(42696089-42696202)
chr2 (103-219)||(12835324-12835440)
chr2 (104-218)||(3172417-3172532)
chr2 (104-218)||(31644841-31644956)
chr2 (101-192)||(34317795-34317886)
chr2 (99-192)||(42695863-42695956)
chr2 (104-219)||(43597387-43597499)
chr2 (102-194)||(23732037-23732129)
chr2 (103-203)||(36806797-36806897)
chr2 (104-200)||(36815488-36815584)
chr2 (104-219)||(11713730-11713845)
chr2 (104-219)||(19183782-19183897)
chr2 (104-219)||(40301975-40302090)
chr2 (104-215)||(40302228-40302339)
chr2 (104-195)||(44559062-44559153)
chr2 (105-219)||(3838149-3838263)
chr2 (104-194)||(4424095-4424185)
chr2 (101-219)||(11713482-11713600)
chr2 (102-219)||(41693888-41694005)
chr2 (104-192)||(4423895-4423983)
chr2 (102-194)||(5334749-5334841)
chr2 (104-192)||(18113089-18113177)
chr2 (104-192)||(20131317-20131405)
chr2 (107-218)||(1696341-1696452)
chr2 (104-199)||(16673676-16673771)
chr2 (104-199)||(32476095-32476190)
chr2 (104-220)||(37910756-37910871)
chr2 (105-160)||(20939269-20939324)
chr2 (101-219)||(26813863-26813980)
chr2 (106-205)||(29182342-29182440)
chr2 (104-159)||(33576062-33576117)
chr2 (104-159)||(41451837-41451892)
chr2 (106-192)||(44559321-44559407)
chr2 (103-192)||(5334952-5335041)
chr2 (101-159)||(5790844-5790902)
chr2 (104-219)||(23989838-23989950)
chr2 (104-192)||(4794130-4794218)
chr2 (104-192)||(10671630-10671718)
chr2 (104-192)||(16673411-16673499)
chr2 (107-219)||(17912452-17912563)
chr2 (104-192)||(23732241-23732328)
chr2 (104-218)||(24483780-24483891)
chr2 (104-192)||(25705361-25705449)
chr2 (104-192)||(36815747-36815835)
chr2 (104-160)||(2265341-2265397)
chr2 (103-219)||(10374959-10375070)
chr2 (104-219)||(10665179-10665294)
chr2 (104-160)||(16522991-16523047)
chr2 (104-160)||(17302087-17302143)
chr2 (104-217)||(22881613-22881723)
chr2 (104-219)||(26814114-26814229)
chr2 (170-218)||(29832040-29832088)
chr2 (100-160)||(34964103-34964163)
chr2 (104-160)||(35155563-35155619)
chr2 (104-160)||(36622250-36622306)
chr2 (104-218)||(38639412-38639524)
chr2 (104-219)||(38980139-38980253)
chr2 (99-218)||(43788853-43788972)
chr2 (104-219)||(44073692-44073807)
chr2 (106-192)||(146328-146414)
chr2 (181-220)||(146536-146575)
chr2 (111-214)||(1295190-1295292)
chr2 (106-216)||(1497833-1497943)
chr2 (181-220)||(2481403-2481442)
chr2 (101-156)||(4042838-4042893)
chr2 (181-220)||(16673621-16673660)
chr2 (181-220)||(20131527-20131566)
chr2 (126-218)||(22881857-22881946)
chr2 (181-220)||(25705200-25705239)
chr2 (102-192)||(29859485-29859575)
chr2 (181-220)||(29859697-29859736)
chr2 (105-160)||(29865222-29865277)
chr2 (181-220)||(30215716-30215755)
chr2 (104-218)||(35685972-35686086)
chr2 (104-218)||(37271739-37271853)
chr2 (104-206)||(39367658-39367760)
chr2 (102-192)||(40124964-40125054)
chr2 (181-220)||(41452047-41452086)
chr2 (104-218)||(44985870-44985984)
chr2 (173-219)||(3671070-3671116)
chr2 (107-215)||(3832525-3832634)
chr2 (104-218)||(5163953-5164062)
chr2 (104-215)||(7814629-7814737)
chr2 (102-160)||(11788050-11788108)
chr2 (182-220)||(14003589-14003627)
chr2 (107-192)||(15842464-15842549)
chr2 (104-219)||(20658061-20658173)
chr2 (100-158)||(27109069-27109127)
chr2 (104-219)||(33732862-33732973)
chr2 (102-160)||(38231429-38231487)
chr2 (104-219)||(38731829-38731941)
chr2 (104-218)||(43597154-43597264)
chr2 (173-219)||(43789077-43789123)
chr2 (106-219)||(44985623-44985735)
chr2 (102-218)||(1497608-1497723)
chr2 (104-192)||(2481193-2481281)
chr2 (109-198)||(4794380-4794468)
chr2 (170-207)||(7121207-7121244)
chr2 (4-103)||(8267404-8267500)
chr2 (103-160)||(9195053-9195110)
chr2 (99-156)||(10671889-10671946)
chr2 (99-160)||(13850517-13850578)
chr2 (104-192)||(14003409-14003497)
chr2 (173-218)||(14392854-14392899)
chr2 (104-219)||(14393016-14393128)
chr2 (173-218)||(17541450-17541495)
chr2 (173-218)||(20658292-20658337)
chr2 (104-192)||(24358857-24358945)
chr2 (104-215)||(29865402-29865511)
chr2 (104-192)||(30215422-30215510)
chr2 (104-216)||(37271991-37272102)
chr2 (174-219)||(43710448-43710493)
chr2 (104-156)||(3172020-3172072)
chr2 (107-218)||(25954313-25954423)
chr2 (104-219)||(31225962-31226077)
chr2 (104-215)||(31326141-31326252)
chr2 (104-160)||(37228733-37228789)
chr2 (107-218)||(38231707-38231818)
chr2 (104-160)||(40786460-40786516)
chr2 (104-160)||(41693674-41693730)
chr2 (107-206)||(42358702-42358801)
chr2 (104-156)||(45442644-45442696)
chr2 (101-160)||(3671136-3671195)
chr2 (104-194)||(4042610-4042699)
chr2 (107-154)||(5006610-5006657)
chr2 (170-217)||(13850769-13850816)
chr2 (104-159)||(16900151-16900206)
chr2 (104-159)||(16993542-16993597)
chr2 (104-159)||(19184096-19184151)
chr2 (107-219)||(26238816-26238925)
chr2 (104-159)||(26239105-26239160)
chr2 (101-218)||(33733129-33733244)
chr2 (97-156)||(34318031-34318090)
chr2 (181-220)||(36815584-36815623)
chr2 (106-160)||(1137983-1138037)
chr2 (173-219)||(17541662-17541708)
chr2 (173-219)||(17912697-17912743)
chr2 (106-160)||(25299747-25299801)
chr2 (173-219)||(26707939-26707985)
chr2 (181-219)||(27109253-27109291)
chr2 (21-103)||(36076399-36076481)
chr2 (173-219)||(41791086-41791132)
chr2 (105-158)||(4842865-4842918)
chr2 (103-160)||(8046592-8046649)
chr2 (104-215)||(10664984-10665093)
chr2 (107-160)||(16968555-16968608)
chr2 (173-214)||(19184042-19184083)
chr2 (170-207)||(27109300-27109337)
chr2 (104-192)||(29182168-29182256)
chr2 (104-192)||(31909391-31909478)
chr2 (105-218)||(34963796-34963911)
chr2 (173-214)||(36622476-36622517)
chr2 (104-192)||(37911032-37911120)
chr2 (104-219)||(43592046-43592159)
chr2 (104-160)||(3837933-3837989)
chr2 (103-159)||(5790557-5790613)
chr2 (104-160)||(8046329-8046385)
chr2 (104-160)||(9195150-9195206)
chr2 (104-156)||(17541724-17541776)
chr2 (184-220)||(18113303-18113339)
chr2 (104-156)||(25954115-25954167)
chr2 (104-160)||(32691313-32691369)
chr2 (102-158)||(43710379-43710435)
chr2 (104-160)||(43710652-43710708)
chr2 (104-152)||(45442316-45442364)
chr2 (170-205)||(3838061-3838096)
chr2 (170-205)||(4731844-4731879)
chr2 (182-217)||(4794342-4794377)
chr2 (170-205)||(8046496-8046531)
chr2 (105-160)||(10374775-10374830)
chr2 (170-205)||(10374875-10374910)
chr2 (170-205)||(12413998-12414033)
chr2 (170-205)||(12426058-12426093)
chr2 (104-151)||(13215318-13215365)
chr2 (104-159)||(17541382-17541437)
chr2 (170-205)||(19183950-19183985)
chr2 (170-205)||(19831593-19831628)
chr2 (170-205)||(22881768-22881803)
chr2 (170-205)||(23990003-23990038)
chr2 (170-205)||(24483565-24483600)
chr2 (104-155)||(26709696-26709747)
chr2 (170-205)||(26814026-26814061)
chr2 (170-205)||(32691479-32691514)
chr2 (181-220)||(32691521-32691560)
chr2 (110-192)||(35155298-35155380)
chr2 (173-216)||(37228932-37228975)
chr2 (181-220)||(37910870-37910909)
chr2 (170-205)||(38980051-38980086)
chr2 (170-201)||(39367619-39367650)
chr2 (170-205)||(40302143-40302178)
chr2 (170-205)||(40786627-40786662)
chr2 (170-205)||(43710546-43710581)
chr2 (170-205)||(44985788-44985823)
chr2 (170-205)||(45442480-45442515)
chr2 (102-160)||(1295491-1295549)
chr2 (175-205)||(1497742-1497772)
chr2 (175-205)||(5790698-5790728)
chr2 (181-219)||(7814359-7814397)
chr2 (170-220)||(14392913-14392963)
chr2 (181-219)||(22881723-22881761)
chr2 (173-215)||(24483466-24483508)
chr2 (181-219)||(24483607-24483645)
chr2 (104-158)||(27311015-27311069)
chr2 (175-205)||(29865310-29865340)
chr2 (189-219)||(33575869-33575899)
chr2 (181-219)||(38639526-38639564)
chr2 (181-219)||(40302185-40302223)
chr2 (181-215)||(43672143-43672177)
chr2 (175-205)||(44073604-44073634)
chr2 (181-215)||(44559164-44559198)
chr2 (181-218)||(17541530-17541567)
chr2 (107-160)||(19831511-19831564)
chr2 (181-214)||(35155503-35155536)
chr2 (103-159)||(38979888-38979945)
chr2 (173-218)||(38979959-38980004)
chr2 (117-157)||(1138055-1138095)
chr2 (104-160)||(3671003-3671059)
chr2 (173-216)||(5790787-5790831)
chr2 (181-220)||(15842671-15842708)
chr2 (107-155)||(23990145-23990193)
chr2 (106-154)||(25299991-25300038)
chr2 (176-216)||(26709766-26709806)
chr2 (104-160)||(27310876-27310931)
chr2 (189-217)||(33575899-33575927)
chr2 (19-103)||(37605918-37606002)
chr2 (104-156)||(43592328-43592380)
chr2 (104-160)||(44994005-44994061)
[»] chr3 (310 HSPs)
chr3 (101-220)||(9261786-9261905)
chr3 (104-219)||(47336466-47336581)
chr3 (104-220)||(51550330-51550446)
chr3 (103-218)||(26089964-26090079)
chr3 (104-218)||(28452147-28452261)
chr3 (104-220)||(474044-474160)
chr3 (104-220)||(45002269-45002385)
chr3 (104-220)||(15979586-15979701)
chr3 (104-217)||(28552021-28552134)
chr3 (103-220)||(49323781-49323898)
chr3 (104-216)||(12741159-12741271)
chr3 (104-220)||(22008526-22008642)
chr3 (104-220)||(22016044-22016160)
chr3 (104-220)||(31480136-31480252)
chr3 (104-220)||(32119220-32119336)
chr3 (107-219)||(35569021-35569133)
chr3 (104-220)||(43441487-43441603)
chr3 (107-218)||(4322075-4322186)
chr3 (104-218)||(863281-863395)
chr3 (103-220)||(40370284-40370401)
chr3 (104-203)||(54608764-54608863)
chr3 (106-220)||(45006133-45006247)
chr3 (104-216)||(27681570-27681682)
chr3 (106-222)||(30034109-30034225)
chr3 (104-219)||(25609767-25609881)
chr3 (104-215)||(38232241-38232354)
chr3 (104-218)||(47005405-47005519)
chr3 (105-219)||(28418786-28418899)
chr3 (99-208)||(35407687-35407795)
chr3 (103-219)||(45313748-45313864)
chr3 (104-218)||(1721338-1721452)
chr3 (107-220)||(8940163-8940277)
chr3 (104-215)||(30128284-30128393)
chr3 (104-218)||(39436718-39436831)
chr3 (103-192)||(4034716-4034805)
chr3 (107-192)||(36672966-36673051)
chr3 (101-219)||(15016385-15016500)
chr3 (104-200)||(19844485-19844581)
chr3 (104-219)||(45320866-45320979)
chr3 (104-212)||(47114487-47114594)
chr3 (102-218)||(52956381-52956497)
chr3 (104-219)||(13584252-13584367)
chr3 (104-219)||(21159702-21159817)
chr3 (103-218)||(29445953-29446068)
chr3 (170-217)||(20404958-20405005)
chr3 (102-219)||(40169539-40169656)
chr3 (104-192)||(12740907-12740995)
chr3 (104-192)||(29686544-29686632)
chr3 (104-192)||(32119496-32119584)
chr3 (106-214)||(46724545-46724653)
chr3 (104-192)||(47005154-47005242)
chr3 (104-220)||(52342195-52342310)
chr3 (104-218)||(4950037-4950149)
chr3 (104-218)||(14633774-14633889)
chr3 (104-219)||(22155929-22156044)
chr3 (19-103)||(29019883-29019966)
chr3 (104-218)||(29678024-29678136)
chr3 (104-219)||(39436994-39437109)
chr3 (104-219)||(51834608-51834722)
chr3 (104-218)||(21159453-21159567)
chr3 (102-192)||(22008802-22008892)
chr3 (106-153)||(35533281-35533328)
chr3 (102-192)||(43441268-43441358)
chr3 (105-218)||(3361704-3361817)
chr3 (102-160)||(7957170-7957228)
chr3 (104-217)||(12673644-12673757)
chr3 (107-219)||(20757403-20757513)
chr3 (105-218)||(22156179-22156292)
chr3 (106-219)||(29955300-29955413)
chr3 (106-219)||(30004454-30004567)
chr3 (104-154)||(35177255-35177305)
chr3 (104-192)||(474320-474408)
chr3 (173-218)||(3151818-3151863)
chr3 (104-219)||(4513507-4513620)
chr3 (106-218)||(14633547-14633659)
chr3 (104-192)||(28552295-28552383)
chr3 (104-215)||(30130158-30130267)
chr3 (107-160)||(40545783-40545836)
chr3 (104-192)||(51550082-51550170)
chr3 (104-192)||(54608518-54608606)
chr3 (104-215)||(3152001-3152111)
chr3 (104-160)||(9863348-9863404)
chr3 (104-156)||(13514525-13514577)
chr3 (106-217)||(19297836-19297947)
chr3 (104-160)||(25615975-25616031)
chr3 (104-156)||(29446154-29446206)
chr3 (104-160)||(29490687-29490743)
chr3 (102-158)||(29678333-29678389)
chr3 (104-160)||(30268505-30268561)
chr3 (104-219)||(34238598-34238712)
chr3 (104-219)||(51759819-51759934)
chr3 (104-160)||(53701607-53701663)
chr3 (181-220)||(474159-474198)
chr3 (104-218)||(3830402-3830516)
chr3 (104-218)||(7518090-7518203)
chr3 (181-220)||(8940276-8940315)
chr3 (173-216)||(10977229-10977272)
chr3 (181-220)||(12741117-12741156)
chr3 (181-220)||(22008641-22008680)
chr3 (181-220)||(22016159-22016198)
chr3 (102-192)||(26089728-26089818)
chr3 (102-192)||(31480412-31480502)
chr3 (173-220)||(39071927-39071974)
chr3 (126-216)||(39132564-39132654)
chr3 (105-160)||(46724846-46724901)
chr3 (181-220)||(49323897-49323936)
chr3 (104-218)||(50009171-50009284)
chr3 (181-220)||(51550292-51550331)
chr3 (173-219)||(275510-275556)
chr3 (107-192)||(863564-863649)
chr3 (107-192)||(3387268-3387353)
chr3 (181-219)||(3387476-3387514)
chr3 (104-219)||(3830134-3830245)
chr3 (100-189)||(4034968-4035057)
chr3 (104-219)||(4814787-4814898)
chr3 (102-215)||(8510212-8510325)
chr3 (103-192)||(15979337-15979426)
chr3 (173-219)||(20907343-20907389)
chr3 (181-219)||(28552135-28552173)
chr3 (104-216)||(31869846-31869956)
chr3 (104-154)||(40279285-40279335)
chr3 (173-219)||(45161180-45161226)
chr3 (173-219)||(45320688-45320734)
chr3 (107-192)||(49324058-49324143)
chr3 (104-157)||(9262102-9262155)
chr3 (104-192)||(9597007-9597095)
chr3 (104-192)||(9603629-9603717)
chr3 (103-219)||(10976977-10977092)
chr3 (104-219)||(20612785-20612898)
chr3 (103-160)||(25710814-25710871)
chr3 (104-216)||(26799888-26800000)
chr3 (99-219)||(28427240-28427360)
chr3 (170-219)||(29955546-29955595)
chr3 (104-188)||(30034388-30034472)
chr3 (104-157)||(40370536-40370589)
chr3 (101-201)||(44802279-44802378)
chr3 (183-220)||(45002233-45002270)
chr3 (104-192)||(47336228-47336316)
chr3 (170-219)||(53113648-53113697)
chr3 (106-217)||(2486581-2486692)
chr3 (104-156)||(3387552-3387604)
chr3 (104-160)||(4513263-4513319)
chr3 (104-160)||(7588318-7588374)
chr3 (107-159)||(8940470-8940522)
chr3 (104-215)||(28427498-28427608)
chr3 (104-160)||(30106164-30106220)
chr3 (104-160)||(30424628-30424684)
chr3 (181-217)||(31480254-31480290)
chr3 (104-160)||(40545564-40545620)
chr3 (104-219)||(46186656-46186771)
chr3 (104-160)||(48924184-48924240)
chr3 (181-221)||(52342331-52342371)
chr3 (104-156)||(52342531-52342583)
chr3 (181-220)||(9261904-9261943)
chr3 (105-160)||(9596759-9596814)
chr3 (104-194)||(9603829-9603919)
chr3 (105-160)||(11311433-11311488)
chr3 (105-160)||(11463233-11463288)
chr3 (181-220)||(15979548-15979587)
chr3 (170-217)||(30004703-30004750)
chr3 (104-202)||(35936780-35936878)
chr3 (104-159)||(37506867-37506922)
chr3 (104-159)||(37507167-37507222)
chr3 (104-155)||(39288573-39288624)
chr3 (104-159)||(45002021-45002076)
chr3 (102-192)||(45005884-45005974)
chr3 (104-159)||(46622074-46622129)
chr3 (104-158)||(3151750-3151804)
chr3 (181-219)||(3151864-3151902)
chr3 (104-216)||(4814540-4814650)
chr3 (173-219)||(4950253-4950299)
chr3 (173-219)||(10778618-10778664)
chr3 (173-219)||(13584072-13584118)
chr3 (102-160)||(16123137-16123195)
chr3 (173-219)||(18175855-18175901)
chr3 (173-219)||(19656789-19656835)
chr3 (102-160)||(20644503-20644561)
chr3 (104-154)||(28942525-28942575)
chr3 (177-219)||(39288785-39288827)
chr3 (170-216)||(45313565-45313611)
chr3 (105-218)||(46186410-46186523)
chr3 (104-154)||(46901104-46901154)
chr3 (106-160)||(50196301-50196355)
chr3 (173-219)||(51500572-51500618)
chr3 (173-219)||(51834828-51834874)
chr3 (102-205)||(53701359-53701459)
chr3 (107-160)||(1721092-1721145)
chr3 (183-220)||(9596845-9596882)
chr3 (104-157)||(14772211-14772264)
chr3 (182-215)||(20405009-20405042)
chr3 (104-192)||(20405135-20405223)
chr3 (104-192)||(35565508-35565596)
chr3 (105-154)||(36673195-36673244)
chr3 (105-158)||(50008921-50008974)
chr3 (104-192)||(54767171-54767259)
chr3 (104-160)||(5345633-5345689)
chr3 (175-219)||(9863290-9863334)
chr3 (96-160)||(19844257-19844321)
chr3 (104-219)||(20644761-20644876)
chr3 (104-160)||(21553889-21553945)
chr3 (104-219)||(25710510-25710624)
chr3 (182-214)||(26089910-26089942)
chr3 (104-156)||(29525105-29525157)
chr3 (126-158)||(30552168-30552200)
chr3 (104-148)||(44802504-44802548)
chr3 (174-218)||(47902034-47902078)
chr3 (107-159)||(49670477-49670529)
chr3 (182-218)||(54767421-54767457)
chr3 (170-205)||(275609-275644)
chr3 (170-205)||(4950165-4950200)
chr3 (170-205)||(5048183-5048218)
chr3 (170-205)||(10778530-10778565)
chr3 (170-205)||(10977145-10977180)
chr3 (170-205)||(13584171-13584206)
chr3 (170-205)||(14633685-14633720)
chr3 (170-205)||(15016545-15016580)
chr3 (170-205)||(15286302-15286337)
chr3 (170-205)||(18175954-18175989)
chr3 (170-205)||(20757566-20757601)
chr3 (170-205)||(22156097-22156132)
chr3 (105-156)||(25610078-25610129)
chr3 (170-205)||(25710670-25710705)
chr3 (170-205)||(28427406-28427441)
chr3 (104-159)||(28452321-28452376)
chr3 (104-159)||(28942850-28942905)
chr3 (170-205)||(29955466-29955501)
chr3 (170-205)||(30004620-30004655)
chr3 (170-205)||(30552311-30552346)
chr3 (104-159)||(30552423-30552478)
chr3 (170-205)||(31724532-31724567)
chr3 (181-220)||(32119335-32119374)
chr3 (170-205)||(33794612-33794647)
chr3 (104-159)||(34582524-34582579)
chr3 (107-154)||(36732643-36732690)
chr3 (170-205)||(37507034-37507069)
chr3 (170-205)||(39288697-39288732)
chr3 (104-159)||(39288843-39288898)
chr3 (104-159)||(40169344-40169399)
chr3 (170-205)||(40169451-40169486)
chr3 (170-205)||(45320778-45320813)
chr3 (170-205)||(45521716-45521751)
chr3 (170-205)||(46186568-46186603)
chr3 (170-205)||(49670636-49670671)
chr3 (174-217)||(50196545-50196588)
chr3 (170-205)||(50261739-50261774)
chr3 (104-159)||(51500630-51500685)
chr3 (104-159)||(51834887-51834942)
chr3 (104-151)||(53113443-53113490)
chr3 (170-205)||(53701526-53701561)
chr3 (174-219)||(275720-275766)
chr3 (181-219)||(3361664-3361702)
chr3 (117-159)||(7957112-7957154)
chr3 (117-159)||(8555193-8555235)
chr3 (117-159)||(9603702-9603744)
chr3 (181-219)||(9863156-9863194)
chr3 (173-219)||(15016633-15016679)
chr3 (181-219)||(16123350-16123388)
chr3 (173-219)||(19656609-19656655)
chr3 (170-208)||(20907252-20907290)
chr3 (181-219)||(21159569-21159607)
chr3 (117-159)||(25610016-25610058)
chr3 (175-205)||(28942686-28942716)
chr3 (126-160)||(31869616-31869650)
chr3 (175-205)||(31869755-31869785)
chr3 (173-219)||(37506935-37506981)
chr3 (170-220)||(39071996-39072046)
chr3 (117-159)||(39132792-39132834)
chr3 (104-158)||(43440495-43440549)
chr3 (106-156)||(43440735-43440785)
chr3 (102-160)||(47902089-47902147)
chr3 (173-218)||(49670541-49670589)
chr3 (175-205)||(50196470-50196500)
chr3 (181-218)||(2439887-2439924)
chr3 (181-218)||(3830340-3830377)
chr3 (181-218)||(5048225-5048262)
chr3 (174-215)||(7518337-7518378)
chr3 (110-159)||(8510474-8510523)
chr3 (181-218)||(10977187-10977224)
chr3 (181-218)||(12673759-12673796)
chr3 (181-218)||(14783956-14783993)
chr3 (181-218)||(19656657-19656694)
chr3 (176-205)||(20124841-20124870)
chr3 (173-206)||(20611088-20611121)
chr3 (181-218)||(25710626-25710663)
chr3 (173-214)||(28942796-28942837)
chr3 (181-218)||(30105973-30106010)
chr3 (181-218)||(30268691-30268728)
chr3 (181-218)||(35565719-35565756)
chr3 (181-218)||(39288653-39288690)
chr3 (181-218)||(39436862-39436899)
chr3 (107-160)||(45161116-45161169)
chr3 (170-219)||(45161279-45161328)
chr3 (107-160)||(45521780-45521833)
chr3 (99-159)||(49670747-49670808)
chr3 (99-160)||(50196601-50196662)
chr3 (177-206)||(51500483-51500512)
chr3 (107-160)||(54767471-54767524)
chr3 (106-154)||(7518396-7518444)
chr3 (75-103)||(26104480-26104508)
chr3 (171-199)||(29686775-29686803)
chr3 (104-160)||(29955610-29955666)
chr3 (104-160)||(30004765-30004821)
chr3 (181-217)||(30034225-30034261)
chr3 (181-217)||(34238807-34238843)
chr3 (103-155)||(35533567-35533619)
chr3 (104-160)||(39132850-39132906)
chr3 (104-160)||(40277822-40277878)
chr3 (104-160)||(40979654-40979710)
chr3 (104-156)||(46751271-46751323)
chr3 (183-219)||(50196509-50196545)
[»] scaffold0024 (3 HSPs)
scaffold0024 (104-220)||(75359-75475)
scaffold0024 (104-192)||(75676-75764)
scaffold0024 (181-220)||(75515-75554)
[»] chr7 (242 HSPs)
chr7 (104-220)||(1614788-1614904)
chr7 (104-220)||(5234088-5234204)
chr7 (104-220)||(9659573-9659689)
chr7 (104-220)||(25988385-25988501)
chr7 (104-218)||(8144295-8144409)
chr7 (104-220)||(23399860-23399976)
chr7 (104-220)||(45228802-45228918)
chr7 (103-220)||(27037592-27037709)
chr7 (104-220)||(44568574-44568690)
chr7 (104-204)||(46828944-46829044)
chr7 (104-220)||(48192372-48192488)
chr7 (104-215)||(29198551-29198662)
chr7 (103-220)||(35469879-35469996)
chr7 (104-220)||(30223679-30223795)
chr7 (104-220)||(41053842-41053958)
chr7 (104-211)||(48853963-48854070)
chr7 (104-206)||(35838235-35838337)
chr7 (104-206)||(5354768-5354870)
chr7 (107-215)||(31503423-31503531)
chr7 (104-216)||(12932672-12932783)
chr7 (105-220)||(27458603-27458716)
chr7 (107-206)||(39520628-39520727)
chr7 (102-196)||(16853497-16853591)
chr7 (104-218)||(28262713-28262827)
chr7 (107-213)||(48192260-48192365)
chr7 (103-219)||(24717417-24717533)
chr7 (104-204)||(25092448-25092548)
chr7 (104-192)||(27458399-27458487)
chr7 (104-212)||(34878017-34878125)
chr7 (104-188)||(46759858-46759942)
chr7 (104-219)||(18022589-18022704)
chr7 (104-194)||(3975549-3975639)
chr7 (104-219)||(488961-489072)
chr7 (104-219)||(17999610-17999721)
chr7 (101-218)||(39833122-39833239)
chr7 (104-192)||(1614559-1614647)
chr7 (104-219)||(6892144-6892260)
chr7 (104-192)||(25092160-25092248)
chr7 (104-192)||(26877678-26877766)
chr7 (99-219)||(28911572-28911692)
chr7 (104-219)||(6108334-6108449)
chr7 (104-219)||(21554639-21554753)
chr7 (104-219)||(31310365-31310479)
chr7 (104-219)||(35015105-35015220)
chr7 (104-160)||(44958450-44958506)
chr7 (94-219)||(10357991-10358117)
chr7 (104-194)||(23676362-23676452)
chr7 (177-220)||(25092408-25092451)
chr7 (104-215)||(28528905-28529015)
chr7 (104-159)||(35104078-35104133)
chr7 (105-160)||(37527366-37527421)
chr7 (104-190)||(46759658-46759744)
chr7 (107-192)||(23676135-23676220)
chr7 (104-215)||(44344681-44344789)
chr7 (107-200)||(6589180-6589271)
chr7 (104-192)||(8144570-8144658)
chr7 (96-192)||(9659347-9659443)
chr7 (104-204)||(11767175-11767275)
chr7 (99-219)||(19783810-19783929)
chr7 (104-192)||(23399612-23399700)
chr7 (104-192)||(25988661-25988749)
chr7 (104-192)||(29198303-29198391)
chr7 (107-219)||(30352563-30352675)
chr7 (104-188)||(35837924-35838008)
chr7 (108-212)||(37372441-37372544)
chr7 (104-219)||(37372791-37372904)
chr7 (104-200)||(38486478-38486574)
chr7 (104-192)||(39438941-39439029)
chr7 (103-219)||(39719352-39719468)
chr7 (104-192)||(41054148-41054236)
chr7 (104-214)||(6911082-6911193)
chr7 (103-218)||(10358254-10358369)
chr7 (100-156)||(13769770-13769826)
chr7 (104-160)||(19561394-19561450)
chr7 (104-160)||(20388274-20388330)
chr7 (102-219)||(21554391-21554505)
chr7 (104-160)||(35210459-35210515)
chr7 (104-160)||(39832906-39832962)
chr7 (181-220)||(1614750-1614789)
chr7 (181-220)||(5234018-5234057)
chr7 (101-219)||(7431948-7432066)
chr7 (104-218)||(8555685-8555799)
chr7 (181-220)||(23399822-23399861)
chr7 (181-220)||(25092370-25092409)
chr7 (102-215)||(25547381-25547492)
chr7 (104-159)||(26878016-26878071)
chr7 (104-159)||(30223461-30223516)
chr7 (104-155)||(30709593-30709644)
chr7 (106-218)||(43058752-43058860)
chr7 (102-215)||(44508718-44508829)
chr7 (181-220)||(44568536-44568575)
chr7 (173-219)||(1007115-1007161)
chr7 (103-218)||(1974008-1974118)
chr7 (3-103)||(2746730-2746827)
chr7 (104-201)||(3807864-3807961)
chr7 (181-219)||(8144410-8144448)
chr7 (173-219)||(19561216-19561262)
chr7 (173-219)||(30709392-30709438)
chr7 (106-160)||(32189334-32189388)
chr7 (102-159)||(1006833-1006890)
chr7 (104-192)||(3975751-3975838)
chr7 (104-192)||(5233808-5233896)
chr7 (104-205)||(6509208-6509311)
chr7 (102-194)||(16940962-16941054)
chr7 (104-215)||(19757748-19757860)
chr7 (102-151)||(28529162-28529211)
chr7 (104-192)||(39520398-39520486)
chr7 (104-192)||(44568326-44568414)
chr7 (173-218)||(44841606-44841651)
chr7 (103-160)||(46829256-46829313)
chr7 (104-192)||(48852444-48852532)
chr7 (104-160)||(2945789-2945845)
chr7 (104-215)||(5308577-5308686)
chr7 (170-214)||(6846851-6846895)
chr7 (19-103)||(7738827-7738911)
chr7 (173-217)||(12894108-12894152)
chr7 (104-160)||(12894346-12894402)
chr7 (104-156)||(14543710-14543762)
chr7 (104-160)||(28911850-28911906)
chr7 (170-218)||(35015004-35015052)
chr7 (104-160)||(35104239-35104295)
chr7 (104-160)||(35210182-35210238)
chr7 (104-155)||(38186709-38186761)
chr7 (104-160)||(41364884-41364940)
chr7 (102-158)||(44403195-44403251)
chr7 (104-219)||(45073314-45073429)
chr7 (102-154)||(48359025-48359077)
chr7 (104-218)||(1559343-1559457)
chr7 (102-219)||(5308321-5308439)
chr7 (104-214)||(19005598-19005708)
chr7 (181-220)||(25988500-25988539)
chr7 (107-158)||(34877777-34877828)
chr7 (104-159)||(44508999-44509054)
chr7 (101-160)||(46304328-46304387)
chr7 (173-215)||(488781-488823)
chr7 (173-219)||(1559592-1559638)
chr7 (104-216)||(6509360-6509470)
chr7 (102-156)||(6589019-6589073)
chr7 (181-219)||(11767128-11767166)
chr7 (106-160)||(17854151-17854205)
chr7 (106-160)||(28263015-28263069)
chr7 (181-215)||(29198513-29198547)
chr7 (107-192)||(31503695-31503780)
chr7 (106-160)||(37952671-37952725)
chr7 (173-219)||(45021564-45021610)
chr7 (182-220)||(46759754-46759792)
chr7 (181-218)||(6892105-6892142)
chr7 (104-192)||(16940762-16940850)
chr7 (104-215)||(23816925-23817034)
chr7 (174-219)||(31732337-31732382)
chr7 (106-151)||(37159861-37159906)
chr7 (173-214)||(45021746-45021787)
chr7 (104-215)||(45073532-45073641)
chr7 (117-192)||(1271511-1271586)
chr7 (108-160)||(6954862-6954914)
chr7 (104-160)||(17999465-17999521)
chr7 (104-160)||(21223405-21223461)
chr7 (104-160)||(23816670-23816726)
chr7 (174-214)||(31732168-31732208)
chr7 (184-220)||(35469997-35470033)
chr7 (181-217)||(35470033-35470069)
chr7 (107-155)||(37953000-37953048)
chr7 (181-217)||(38186483-38186519)
chr7 (104-160)||(39719586-39719642)
chr7 (104-156)||(46304086-46304138)
chr7 (104-152)||(46648667-46648715)
chr7 (170-205)||(488880-488915)
chr7 (179-218)||(2945555-2945594)
chr7 (189-220)||(5234058-5234089)
chr7 (105-160)||(6079810-6079865)
chr7 (107-158)||(11766920-11766971)
chr7 (170-205)||(12894200-12894235)
chr7 (173-220)||(14738890-14738937)
chr7 (170-205)||(17999522-17999557)
chr7 (170-205)||(18022533-18022568)
chr7 (170-205)||(18311747-18311782)
chr7 (173-216)||(18311831-18311874)
chr7 (170-205)||(19465785-19465820)
chr7 (103-154)||(19561153-19561204)
chr7 (170-205)||(19757917-19757952)
chr7 (170-205)||(28911745-28911780)
chr7 (101-160)||(31732098-31732157)
chr7 (170-205)||(31732249-31732284)
chr7 (170-205)||(32189193-32189228)
chr7 (170-205)||(35210310-35210345)
chr7 (170-205)||(37372703-37372738)
chr7 (104-155)||(39438741-39438792)
chr7 (170-205)||(39719521-39719556)
chr7 (170-205)||(43058877-43058912)
chr7 (105-156)||(43300613-43300664)
chr7 (170-205)||(44508886-44508921)
chr7 (170-205)||(45021663-45021698)
chr7 (170-205)||(45073440-45073475)
chr7 (181-219)||(1006982-1007020)
chr7 (173-215)||(1271304-1271346)
chr7 (175-205)||(1974124-1974154)
chr7 (117-155)||(3808068-3808106)
chr7 (122-160)||(3954138-3954176)
chr7 (177-219)||(6108583-6108625)
chr7 (106-160)||(6847063-6847117)
chr7 (182-212)||(9659536-9659566)
chr7 (173-215)||(14738667-14738709)
chr7 (181-219)||(14738808-14738846)
chr7 (104-158)||(21223694-21223748)
chr7 (104-206)||(22539930-22540023)
chr7 (102-152)||(32189074-32189124)
chr7 (104-138)||(36687229-36687263)
chr7 (117-159)||(39438914-39438956)
chr7 (177-215)||(41365005-41365043)
chr7 (173-215)||(46304272-46304314)
chr7 (173-218)||(1006903-1006948)
chr7 (176-205)||(1559504-1559533)
chr7 (118-155)||(6887174-6887211)
chr7 (181-218)||(10358212-10358249)
chr7 (181-218)||(12894156-12894193)
chr7 (105-154)||(18022368-18022417)
chr7 (181-218)||(19465827-19465864)
chr7 (104-157)||(20355408-20355461)
chr7 (181-218)||(28262830-28262867)
chr7 (107-156)||(30709328-30709377)
chr7 (170-215)||(37159669-37159714)
chr7 (181-218)||(37372659-37372696)
chr7 (107-160)||(38186369-38186422)
chr7 (175-204)||(44344590-44344619)
chr7 (104-200)||(44402960-44403056)
chr7 (181-218)||(44508928-44508965)
chr7 (107-160)||(44841359-44841412)
chr7 (103-159)||(45021493-45021550)
chr7 (104-160)||(1559649-1559705)
chr7 (107-155)||(5355066-5355114)
chr7 (104-152)||(8555607-8555655)
chr7 (104-160)||(13770025-13770081)
chr7 (99-155)||(18927040-18927096)
chr7 (117-157)||(19005825-19005865)
chr7 (173-205)||(19465686-19465718)
chr7 (104-160)||(19465925-19465980)
chr7 (170-218)||(20388441-20388489)
chr7 (103-159)||(30352849-30352905)
chr7 (170-202)||(31310480-31310512)
chr7 (104-160)||(35470224-35470280)
chr7 (104-160)||(35665877-35665933)
chr7 (173-217)||(41365102-41365146)
[»] chr6 (211 HSPs)
chr6 (104-220)||(21993787-21993903)
chr6 (104-217)||(6412218-6412331)
chr6 (104-220)||(22543354-22543470)
chr6 (104-220)||(21385468-21385584)
chr6 (104-219)||(3414387-3414502)
chr6 (104-215)||(18024264-18024375)
chr6 (104-220)||(3968893-3969009)
chr6 (104-220)||(20467602-20467718)
chr6 (104-219)||(25137242-25137357)
chr6 (104-220)||(17765009-17765126)
chr6 (104-218)||(12299026-12299140)
chr6 (104-218)||(23502426-23502540)
chr6 (103-219)||(34582528-34582644)
chr6 (103-218)||(19267564-19267679)
chr6 (104-218)||(12757610-12757724)
chr6 (105-215)||(30479311-30479421)
chr6 (101-218)||(19690646-19690762)
chr6 (103-219)||(30928931-30929045)
chr6 (103-191)||(10910628-10910716)
chr6 (104-192)||(10910876-10910964)
chr6 (104-218)||(8169787-8169902)
chr6 (104-220)||(19321016-19321131)
chr6 (104-219)||(25431743-25431854)
chr6 (170-220)||(3276091-3276141)
chr6 (102-218)||(11925737-11925854)
chr6 (100-220)||(23770157-23770275)
chr6 (104-192)||(3968645-3968733)
chr6 (104-192)||(17765287-17765375)
chr6 (104-192)||(19129432-19129520)
chr6 (99-219)||(19296292-19296412)
chr6 (104-192)||(21385251-21385339)
chr6 (104-192)||(22543630-22543718)
chr6 (104-219)||(8680775-8680890)
chr6 (104-160)||(19690393-19690449)
chr6 (104-214)||(11448537-11448646)
chr6 (107-205)||(12176542-12176640)
chr6 (106-192)||(13617531-13617617)
chr6 (104-218)||(15962027-15962141)
chr6 (103-212)||(30239292-30239399)
chr6 (104-158)||(1214942-1214996)
chr6 (104-192)||(1007124-1007212)
chr6 (99-160)||(1007453-1007514)
chr6 (104-192)||(3414664-3414752)
chr6 (173-218)||(5286838-5286883)
chr6 (104-216)||(7156048-7156160)
chr6 (99-219)||(12419823-12419943)
chr6 (170-215)||(15443225-15443270)
chr6 (181-222)||(20467561-20467602)
chr6 (104-192)||(21994315-21994403)
chr6 (102-155)||(24901237-24901290)
chr6 (173-218)||(30037975-30038020)
chr6 (104-192)||(31198615-31198703)
chr6 (104-156)||(3276302-3276354)
chr6 (104-156)||(9896585-9896637)
chr6 (107-216)||(10091039-10091145)
chr6 (104-160)||(14656204-14656260)
chr6 (104-219)||(15076090-15076204)
chr6 (104-160)||(15722610-15722666)
chr6 (1-103)||(24209241-24209340)
chr6 (94-219)||(24692867-24692989)
chr6 (104-160)||(24901498-24901554)
chr6 (104-160)||(25136994-25137050)
chr6 (104-206)||(30928681-30928781)
chr6 (104-219)||(31398427-31398541)
chr6 (181-220)||(3968855-3968894)
chr6 (104-218)||(6468310-6468423)
chr6 (104-155)||(8170100-8170151)
chr6 (104-159)||(8681061-8681116)
chr6 (181-220)||(21993943-21993982)
chr6 (181-220)||(22543469-22543508)
chr6 (105-219)||(31166871-31166984)
chr6 (117-159)||(1214767-1214809)
chr6 (173-219)||(1890128-1890174)
chr6 (173-219)||(2616121-2616167)
chr6 (181-219)||(6412331-6412369)
chr6 (173-219)||(15116740-15116786)
chr6 (102-160)||(15962333-15962391)
chr6 (173-219)||(17321573-17321619)
chr6 (102-160)||(18024009-18024067)
chr6 (173-219)||(24273906-24273952)
chr6 (104-216)||(543612-543724)
chr6 (104-192)||(6412491-6412579)
chr6 (173-217)||(1890340-1890384)
chr6 (104-160)||(2373179-2373235)
chr6 (173-217)||(2615938-2615982)
chr6 (102-158)||(12298820-12298876)
chr6 (104-160)||(21147404-21147460)
chr6 (104-160)||(25121440-25121496)
chr6 (104-160)||(33131794-33131850)
chr6 (104-219)||(33801629-33801743)
chr6 (104-219)||(34582778-34582892)
chr6 (108-218)||(543365-543474)
chr6 (99-154)||(11925983-11926038)
chr6 (104-214)||(14655379-14655489)
chr6 (173-216)||(15116933-15116976)
chr6 (106-192)||(19320769-19320855)
chr6 (104-218)||(22822537-22822651)
chr6 (104-159)||(24274076-24274131)
chr6 (173-220)||(32885741-32885788)
chr6 (102-156)||(494403-494457)
chr6 (170-220)||(494545-494595)
chr6 (170-216)||(1007369-1007415)
chr6 (173-219)||(5286654-5286700)
chr6 (173-219)||(6468558-6468604)
chr6 (117-215)||(6564595-6564692)
chr6 (107-219)||(7324079-7324189)
chr6 (173-219)||(9896344-9896390)
chr6 (126-203)||(13150651-13150728)
chr6 (104-158)||(13268109-13268163)
chr6 (99-160)||(318041-318102)
chr6 (181-218)||(3414504-3414541)
chr6 (173-214)||(7155865-7155906)
chr6 (173-214)||(12176451-12176492)
chr6 (173-218)||(12419776-12419821)
chr6 (181-218)||(13268312-13268349)
chr6 (107-160)||(26375989-26376042)
chr6 (102-159)||(31167145-31167202)
chr6 (173-218)||(33808689-33808734)
chr6 (104-160)||(317812-317868)
chr6 (173-217)||(777928-777972)
chr6 (104-160)||(6564888-6564943)
chr6 (104-215)||(12612248-12612359)
chr6 (104-160)||(14655903-14655959)
chr6 (107-159)||(20467354-20467406)
chr6 (104-160)||(21995064-21995120)
chr6 (104-218)||(26375693-26375805)
chr6 (173-205)||(33746928-33746960)
chr6 (173-217)||(34990025-34990069)
chr6 (105-152)||(494704-494751)
chr6 (104-218)||(777677-777790)
chr6 (104-159)||(1890397-1890452)
chr6 (170-205)||(2373291-2373326)
chr6 (170-205)||(2616033-2616068)
chr6 (104-151)||(2616193-2616240)
chr6 (176-219)||(3356210-3356253)
chr6 (107-158)||(3356444-3356495)
chr6 (170-205)||(5286756-5286791)
chr6 (170-205)||(6468470-6468505)
chr6 (104-159)||(7155797-7155852)
chr6 (170-205)||(8680943-8680978)
chr6 (170-205)||(12612156-12612191)
chr6 (117-160)||(13617760-13617803)
chr6 (105-160)||(14428651-14428706)
chr6 (170-205)||(15076002-15076037)
chr6 (170-205)||(15116839-15116874)
chr6 (104-159)||(19129336-19129391)
chr6 (170-205)||(19275839-19275874)
chr6 (170-205)||(20582769-20582804)
chr6 (170-205)||(21995232-21995267)
chr6 (170-205)||(22822423-22822458)
chr6 (104-151)||(23502237-23502284)
chr6 (105-160)||(23628799-23628854)
chr6 (170-205)||(23770320-23770355)
chr6 (170-205)||(24274005-24274040)
chr6 (117-160)||(31276284-31276327)
chr6 (104-159)||(32885673-32885728)
chr6 (170-205)||(32885840-32885875)
chr6 (170-205)||(33131691-33131726)
chr6 (170-205)||(33746891-33746926)
chr6 (175-218)||(33801451-33801494)
chr6 (170-205)||(33801541-33801576)
chr6 (170-205)||(33808781-33808816)
chr6 (104-158)||(1214696-1214750)
chr6 (175-205)||(1890232-1890262)
chr6 (104-158)||(2615872-2615926)
chr6 (181-219)||(2615988-2616026)
chr6 (170-204)||(3356300-3356334)
chr6 (173-215)||(3356391-3356433)
chr6 (181-219)||(6468425-6468463)
chr6 (173-219)||(6591327-6591373)
chr6 (173-215)||(6851505-6851547)
chr6 (170-204)||(7155964-7155998)
chr6 (177-219)||(11129273-11129315)
chr6 (181-219)||(12176497-12176535)
chr6 (117-159)||(13268182-13268224)
chr6 (175-205)||(15962200-15962230)
chr6 (175-205)||(16368761-16368791)
chr6 (181-219)||(17321440-17321478)
chr6 (117-159)||(19129405-19129447)
chr6 (117-155)||(19275185-19275223)
chr6 (102-160)||(21995369-21995427)
chr6 (104-154)||(22822307-22822357)
chr6 (181-219)||(30928798-30928836)
chr6 (29-103)||(33105997-33106071)
chr6 (175-205)||(34990113-34990143)
chr6 (181-218)||(1890270-1890307)
chr6 (106-159)||(5286896-5286949)
chr6 (181-218)||(7156006-7156043)
chr6 (127-160)||(7323891-7323924)
chr6 (181-218)||(8680985-8681022)
chr6 (102-151)||(11129496-11129545)
chr6 (181-218)||(11448750-11448787)
chr6 (101-216)||(13268354-13268463)
chr6 (173-218)||(15962276-15962321)
chr6 (181-218)||(17321308-17321345)
chr6 (103-156)||(17771910-17771963)
chr6 (104-157)||(22792846-22792899)
chr6 (181-218)||(22822465-22822502)
chr6 (173-206)||(25431642-25431675)
chr6 (176-205)||(26375865-26375894)
chr6 (103-160)||(31186535-31186592)
chr6 (107-160)||(34990259-34990312)
chr6 (170-202)||(317976-318008)
chr6 (173-205)||(2373393-2373425)
chr6 (104-156)||(3356142-3356194)
chr6 (106-154)||(6591392-6591440)
chr6 (104-160)||(11449113-11449169)
chr6 (104-156)||(12419708-12419760)
chr6 (104-152)||(12757888-12757936)
chr6 (177-205)||(14428814-14428842)
chr6 (104-160)||(19267856-19267912)
[»] scaffold0160 (1 HSPs)
scaffold0160 (104-218)||(27250-27364)
[»] scaffold0026 (3 HSPs)
scaffold0026 (99-216)||(82594-82711)
scaffold0026 (104-192)||(82341-82429)
scaffold0026 (181-220)||(82552-82591)
[»] scaffold0001 (2 HSPs)
scaffold0001 (104-217)||(148169-148282)
scaffold0001 (183-217)||(148100-148134)
[»] scaffold0056 (5 HSPs)
scaffold0056 (104-220)||(54815-54931)
scaffold0056 (107-159)||(50023-50075)
scaffold0056 (107-159)||(55124-55176)
scaffold0056 (181-220)||(49829-49868)
scaffold0056 (181-220)||(54930-54969)
[»] scaffold0472 (1 HSPs)
scaffold0472 (104-218)||(7151-7264)
[»] scaffold0535 (2 HSPs)
scaffold0535 (99-219)||(8913-9033)
scaffold0535 (106-160)||(8734-8788)
[»] scaffold0373 (2 HSPs)
scaffold0373 (104-219)||(8547-8662)
scaffold0373 (170-205)||(8715-8750)
[»] scaffold0021 (2 HSPs)
scaffold0021 (104-219)||(12182-12297)
scaffold0021 (103-219)||(12421-12537)
[»] scaffold0811 (3 HSPs)
scaffold0811 (104-218)||(1311-1425)
scaffold0811 (104-215)||(1533-1644)
scaffold0811 (170-219)||(1427-1476)
[»] scaffold0051 (2 HSPs)
scaffold0051 (104-217)||(5594-5708)
scaffold0051 (104-155)||(5399-5450)
[»] scaffold0119 (2 HSPs)
scaffold0119 (102-160)||(16722-16780)
scaffold0119 (170-215)||(16977-17022)
[»] scaffold0176 (2 HSPs)
scaffold0176 (104-212)||(21947-22055)
scaffold0176 (117-158)||(21763-21804)
[»] scaffold0078 (2 HSPs)
scaffold0078 (104-216)||(3967-4079)
scaffold0078 (99-160)||(3747-3808)
[»] scaffold0370 (1 HSPs)
scaffold0370 (104-219)||(175-289)
[»] scaffold0684 (2 HSPs)
scaffold0684 (104-218)||(2546-2660)
scaffold0684 (104-152)||(2334-2382)
[»] scaffold0005 (5 HSPs)
scaffold0005 (104-159)||(47925-47980)
scaffold0005 (107-218)||(48116-48228)
scaffold0005 (108-160)||(222817-222869)
scaffold0005 (104-156)||(223120-223172)
scaffold0005 (117-158)||(222884-222925)
[»] scaffold0210 (2 HSPs)
scaffold0210 (104-215)||(14903-15012)
scaffold0210 (104-160)||(14697-14753)
[»] scaffold0179 (2 HSPs)
scaffold0179 (104-215)||(3182-3291)
scaffold0179 (170-205)||(3090-3125)
[»] scaffold0166 (2 HSPs)
scaffold0166 (104-204)||(24372-24472)
scaffold0166 (173-215)||(24549-24591)
[»] scaffold0712 (1 HSPs)
scaffold0712 (104-215)||(5209-5320)
[»] scaffold0709 (1 HSPs)
scaffold0709 (104-215)||(5229-5340)
[»] scaffold0060 (3 HSPs)
scaffold0060 (104-219)||(8330-8445)
scaffold0060 (104-206)||(8540-8642)
scaffold0060 (176-205)||(8504-8533)
[»] scaffold0003 (3 HSPs)
scaffold0003 (104-217)||(366164-366273)
scaffold0003 (170-205)||(366074-366109)
scaffold0003 (104-160)||(365979-366035)
[»] scaffold1001 (3 HSPs)
scaffold1001 (104-216)||(2778-2887)
scaffold1001 (173-219)||(3024-3070)
scaffold1001 (170-205)||(2943-2978)
[»] scaffold0065 (3 HSPs)
scaffold0065 (104-219)||(3806-3918)
scaffold0065 (103-156)||(3531-3584)
scaffold0065 (170-205)||(3718-3753)
[»] scaffold0007 (1 HSPs)
scaffold0007 (103-217)||(2771-2884)
[»] scaffold0337 (2 HSPs)
scaffold0337 (103-156)||(12524-12577)
scaffold0337 (173-205)||(12593-12625)
[»] scaffold0016 (2 HSPs)
scaffold0016 (99-219)||(10163-10270)
scaffold0016 (104-160)||(10459-10515)
[»] scaffold0002 (1 HSPs)
scaffold0002 (104-216)||(94057-94169)
[»] scaffold0326 (6 HSPs)
scaffold0326 (104-156)||(4041-4093)
scaffold0326 (104-156)||(19223-19275)
scaffold0326 (173-216)||(4177-4220)
scaffold0326 (173-216)||(19359-19402)
scaffold0326 (104-156)||(4236-4288)
scaffold0326 (104-156)||(19418-19470)
[»] scaffold0578 (1 HSPs)
scaffold0578 (107-154)||(5020-5067)
[»] scaffold0105 (2 HSPs)
scaffold0105 (105-160)||(17651-17706)
scaffold0105 (102-160)||(17910-17968)
[»] scaffold0347 (1 HSPs)
scaffold0347 (101-219)||(4199-4315)
[»] scaffold0159 (3 HSPs)
scaffold0159 (103-159)||(34930-34986)
scaffold0159 (175-205)||(35071-35101)
scaffold0159 (173-216)||(35160-35204)
[»] scaffold0085 (2 HSPs)
scaffold0085 (170-214)||(34787-34831)
scaffold0085 (104-160)||(35028-35084)
[»] scaffold0428 (1 HSPs)
scaffold0428 (170-205)||(7669-7704)
[»] scaffold0123 (2 HSPs)
scaffold0123 (170-205)||(17841-17876)
scaffold0123 (104-160)||(17987-18043)
[»] scaffold0032 (2 HSPs)
scaffold0032 (170-205)||(33101-33136)
scaffold0032 (182-219)||(33176-33213)
[»] scaffold0339 (1 HSPs)
scaffold0339 (102-154)||(3405-3457)
[»] scaffold0291 (1 HSPs)
scaffold0291 (177-205)||(11216-11244)
[»] scaffold0204 (1 HSPs)
scaffold0204 (106-154)||(17126-17174)
[»] scaffold0069 (1 HSPs)
scaffold0069 (75-103)||(2300-2328)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 290)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 31060785 - 31060903
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||    
31060785 ttggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgt 31060884  T
202 ttttggaaatagtccctgc 220  Q
    |||||||||||||||||||    
31060885 ttttggaaatagtccctgc 31060903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 3247198 - 3247314
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
3247198 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 3247297  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
3247298 ttggaaatagtccctgc 3247314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 8140434 - 8140550
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
8140434 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 8140533  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
8140534 ttggaaatagtccctgc 8140550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 19720712 - 19720827
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
19720712 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 19720811  T
204 ttggaaatagtccctg 219  Q
    ||||||||||||||||    
19720812 ttggaaatagtccctg 19720827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 40718108 - 40718226
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||    
40718108 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgt 40718207  T
202 ttttggaaatagtccctgc 220  Q
    |||||||||||||||||||    
40718208 ttttggaaatagtccctgc 40718226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 45380638 - 45380520
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||    
45380638 ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgt 45380539  T
202 ttttggaaatagtccctgc 220  Q
    |||||||||||||||||||    
45380538 ttttggaaatagtccctgc 45380520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 103 - 220
Target Start/End: Original strand, 35056529 - 35056646
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||||||||||||    
35056529 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgtt 35056628  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
35056629 tttggaaatagtccctgc 35056646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 10631160 - 10631280
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatttt 199  Q
    |||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||| ||||||||||||    
10631160 aattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatatttt 10631259  T
200 gtttttggaaatagtccctgc 220  Q
    | |||||||||||||||||||    
10631260 gattttggaaatagtccctgc 10631280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 15526362 - 15526246
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
15526362 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttgttt 15526263  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
15526262 ttggaaatagtccctgc 15526246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 24507843 - 24507727
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
24507843 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 24507744  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
24507743 ttggaaatagtccctgc 24507727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 30322929 - 30323045
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
30322929 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttgttt 30323028  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
30323029 ttggaaatagtccctgc 30323045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 12360968 - 12360853
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
12360968 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttgttt 12360869  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
12360868 ttgaaaatagtccctg 12360853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 24653800 - 24653918
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||    
24653800 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgt 24653899  T
202 ttttggaaatagtccctgc 220  Q
    |||||||||||||||||||    
24653900 ttttggaaatagtccctgc 24653918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 38164295 - 38164179
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
38164295 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 38164196  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
38164195 ttggaaatagtccctgc 38164179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 47819596 - 47819480
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
47819596 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 47819497  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
47819496 ttggaaatagtccctgc 47819480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 38151214 - 38151096
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | |    
38151214 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattt 38151115  T
202 ttttggaaatagtccctgc 220  Q
    |||||||||||||||||||    
38151114 ttttggaaatagtccctgc 38151096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 10887598 - 10887486
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||| |         ||||||||||||||||||||||||||||||||||    
10887598 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 10887499  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
10887498 ttgaaaatagtcc 10887486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 39747835 - 39747723
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||| ||| |||||||||||||||||    
39747835 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttgatccttgcaaaatattttgttt 39747736  T
204 ttggaaatagtcc 216  Q
    |||||||||||||    
39747735 ttggaaatagtcc 39747723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 105 - 218
Target Start/End: Original strand, 44157696 - 44157809
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||| |||||||||||||||||||||||    
44157696 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttagtccctgcaaaatattttgtttt 44157795  T
205 tggaaatagtccct 218  Q
    || |||||||||||    
44157796 tgaaaatagtccct 44157809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 33000305 - 33000421
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||| |||||||||||||         |||||||||||||||||||||||||||| | |||    
33000305 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattattttt 33000404  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
33000405 ttggaaatagtccctgc 33000421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 26324585 - 26324696
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||| ||| |||||||||||||||||    
26324585 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttgatccttgcaaaatattttgttt 26324684  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
26324685 ttgaaaatagtc 26324696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 103 - 218
Target Start/End: Complemental strand, 33234913 - 33234798
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||||||| ||||||||||| || |||||| |||||||||||||          ||||||||||| ||||||||||||||||||||    
33234913 tggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaatttttgtgttgtttttgatccctgcaaaatattttgtt 33234814  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
33234813 tttgaaaatagtccct 33234798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 101 - 219
Target Start/End: Complemental strand, 12322973 - 12322855
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||||||| |||||||||||||| |||||||||||| |||||||         |||||||||||||||| ||||||||||| ||    
12322973 attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgtaaatttttgttgttgtttttggtccttgcaaaatattctg 12322874  T
201 tttttggaaatagtccctg 219  Q
    |||||| ||||||| ||||    
12322873 tttttgaaaatagtacctg 12322855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 34002940 - 34002827
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||         |||||| ||||||||||| |||||||||||||||    
34002940 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgt-aaatttttttgttggttttggtccctacaaaatattttgttt 34002842  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
34002841 ttgaaaatagtccct 34002827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 101 - 215
Target Start/End: Complemental strand, 48956069 - 48955955
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||| ||||||||||| |||||||||||||||||||||||          | |||||||||||||||||||||| |||||    
48956069 attggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttg 48955970  T
201 tttttggaaatagtc 215  Q
    |||||| ||||||||    
48955969 tttttgaaaatagtc 48955955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 99 - 218
Target Start/End: Complemental strand, 28507463 - 28507344
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||  |||||||| ||||||||||||||  |||| ||||||||||||||         || ||||||||||||||||||||| ||||    
28507463 aaataggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgtaattttttatttttgtttttggtccctgcaaaacattt 28507364  T
199 tgtttttggaaatagtccct 218  Q
    |||||||| |||||||||||    
28507363 tgtttttgaaaatagtccct 28507344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 105 - 215
Target Start/End: Complemental strand, 18928141 - 18928031
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||||||| ||||||||||||||  |||| ||||||||||| ||         || ||||||||||||||||||||||||||||||||    
18928141 gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtcccggtaacatttttttattgtttttggtccctgcaaaatattttgtttt 18928042  T
205 tggaaatagtc 215  Q
    || ||||||||    
18928041 tgaaaatagtc 18928031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 24978122 - 24978008
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  ||||||||   ||||||||| || |||||||||||||| |||||         |||||||||||||||| |||||||||||||||||    
24978122 ggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgtaaattttttttgttgtttttggtccttgcaaaatattttgttt 24978023  T
204 ttggaaatagtccct 218  Q
    |||||||||||||||    
24978022 ttggaaatagtccct 24978008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 101 - 219
Target Start/End: Complemental strand, 35308114 - 35307996
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | ||||||||||||||| |||||| |||||    
35308114 attggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaattttttg 35308015  T
201 tttttggaaatagtccctg 219  Q
    |||||| ||||||||||||    
35308014 tttttgaaaatagtccctg 35307996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 16026573 - 16026690
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnn-ttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||| ||||||||| ||||||||||  || |||||||||||||||||| |          |||||||||||||||||||||||||||| | ||    
16026573 ggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccctttaaaaaaaaaattgttgtttttggtccctgcaaaatattatttt 16026672  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
16026673 tttggaaatagtccctgc 16026690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 8364619 - 8364731
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| ||||| || |||||||||||| | ||||||||||||||| ||||         ||||||||||||||||||||||||||||||  |||||    
8364619 taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgtaatttttttttgttgtttttggtccctgcaaaatattttacttttg 8364718  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
8364719 aaaatagtccctg 8364731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 208
Target Start/End: Original strand, 15211511 - 15211615
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||| |||||||||| ||||||||||||||| ||||         ||||||||||||||||||||||||||||||  ||    
15211511 ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgtaaatttttgttgttgtttttggtccctgcaaaatattttactt 15211610  T
204 ttgga 208  Q
    |||||    
15211611 ttgga 15211615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 107 - 219
Target Start/End: Complemental strand, 15335292 - 15335180
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||||| ||| ||||||||||| || |||||||||||||| |||||          | |||||||||||||||||||||| |||||||||||    
15335292 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtttttg 15335193  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
15335192 aaaatagtccctg 15335180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 36912853 - 36912963
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||     |||||||||         ||||||||||||||||||| ||||||||||||||    
36912853 ggctaaaatatggttttggtccctgcaaatatgtctcgttttg-----agtccctgtaatttttttttgttgtttttggtccctgtaaaatattttgttt 36912947  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
36912948 ttgaaaatagtccctg 36912963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 50429209 - 50429095
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||          | ||||||||||| |||||||||| ||||||||    
50429209 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaat-ttgtttttggttcctgcaaaattttttgttt 50429111  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
50429110 ttgaaaatagtccctg 50429095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 38136983 - 38136893
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
38136983 ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 38136893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 103 - 218
Target Start/End: Complemental strand, 39025382 - 39025269
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| ||||||| ||| || |||||||||||||||||| |         |||||||||||||||||||||| ||||||||||    
39025382 tggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccctataaaaaaaa-ttgttgtttttggtccctgcaagatattttgtt 39025285  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
39025284 tttgaaaatagtccct 39025269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 44641433 - 44641320
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||| ||||| |||||||    
44641433 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgtaaaattttttgtt 44641337  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
44641336 tttgaaaatagtccctg 44641320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 49073691 - 49073805
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||||||  ||||||||||||| |||||||||||| |||||           ||||||||||||||||||||| |||||||||| |    
49073691 ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccctacaaaaaaaaattgttgtttttggtccctgcagaatattttgtat 49073790  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
49073791 ttgaaaatagtccct 49073805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 219
Target Start/End: Complemental strand, 7001899 - 7001782
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||    
7001899 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgt 7001800  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
7001799 ttttgaaaatagtccctg 7001782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 14007489 - 14007601
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||            |||||||||||||||||||||| ||| ||||    
14007489 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaatttttagttt 14007585  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
14007586 ttgaaaatagtccctg 14007601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 101 - 159
Target Start/End: Original strand, 24977775 - 24977833
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
24977775 attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 24977833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 46184051 - 46183938
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||  |||||||| ||| ||||||||||  |||||||||| ||||||||         ||||||||||||||||||| ||||||| |||||||||    
46184051 taaaatatagttttggtccctgtaaatatgtctcattttggttttcgtccctgtaaaaaaaaattgttgtttttggtccctgaaaaatatcttgtttttg 46183952  T
207 gaaatagtccctgc 220  Q
     |||||||||||||    
46183951 aaaatagtccctgc 46183938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 21383104 - 21383215
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| |||| ||||||||| ||||||||||||||||||||             ||||||||||||||||||||| ||||||||    
21383104 ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaaaataaa---atgtttttggtccctgcaaaattttttgttt 21383200  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
21383201 ttgaaaatagtccct 21383215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 212
Target Start/End: Original strand, 26442563 - 26442671
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||| |||          | |||||||||||||||||||||| ||||||||    
26442563 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaggaaattttgtttttggtccctgcaaaattttttgttt 26442662  T
204 ttggaaata 212  Q
    ||| |||||    
26442663 ttgaaaata 26442671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 30323293 - 30323205
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
30323293 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 30323205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 33000669 - 33000581
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
33000669 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 33000581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 35056894 - 35056806
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
35056894 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 35056806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 45380272 - 45380360
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
45380272 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 45380360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 200
Target Start/End: Complemental strand, 45638894 - 45638798
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||| | ||| |         |||||||||||||||||||||||||||||||    
45638894 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcctataaaaaaaaattgttgtttttggtccctgcaaaatattttg 45638798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 48609236 - 48609349
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| | |||||||||||| ||||||||||||||||||||          |  ||||||||||||||||||||| ||||||||    
48609236 ggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaat--tgtttttggtccctgcaaaattttttgttt 48609333  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
48609334 ttgaaaatagtccctg 48609349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 990379 - 990265
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||           | |||||||||||||||||||||| ||||||||    
990379 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaat-ttgtttttggtccctgcaaaattttttgttt 990281  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
990280 ttgaaaatagtccctg 990265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 7819103 - 7818988
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||  |||||||||||||| || ||||||||||||||| ||||            |||||||||||||||||||||| ||||||||    
7819103 ggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 7819004  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
7819003 ttgaaaatagtccctg 7818988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 7867357 - 7867301
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||    
7867357 ggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgt 7867301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 13770489 - 13770603
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | ||||||||||||| |||||||| ||||||||    
13770489 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaat-ttgtttttggtccttgcaaaattttttgttt 13770587  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
13770588 ttgaaaatagtccctg 13770603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 29072497 - 29072612
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
29072497 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 29072596  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
29072597 tttaaaatagtccctg 29072612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 192
Target Start/End: Original strand, 4789310 - 4789396
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||| |||||    
4789310 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaattaatttttgttgtttttggtccccgcaaa 4789396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 107 - 205
Target Start/End: Complemental strand, 5058989 - 5058891
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||| |||||||| ||| ||||||| || |||||| |||||||||||||         ||||||||||||| ||||||||||||||||||||||    
5058989 taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgtaaatttttgttgttgtttttgggccctgcaaaatattttgttttt 5058891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 15516582 - 15516637
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||    
15516582 ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg 15516637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 99 - 200
Target Start/End: Original strand, 42482974 - 42483076
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt-nnnnnnnnnttgttgtttttggtccctgcaaaatatt 197  Q
    |||| |||||||||||| |||||||| ||||||||||||||  |||||||||||||| ||||          ||||||||||||||||||||||||||||    
42482974 aaataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgtaaaaaaaaaattgttgtttttggtccctgcaaaatatt 42483073  T
198 ttg 200  Q
    |||    
42483074 ttg 42483076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 50428873 - 50428987
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  ||||||||||||| |||||| ||||| |||||||         |  |||||||||||||||||||||| ||||||||    
50428873 ggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgtaaaaaaatatatttgtttttggtccctgcaaaattttttgttt 50428972  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
50428973 ttgaaaatagtccct 50428987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 213
Target Start/End: Original strand, 7867129 - 7867238
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  ||||||||||||| ||||| ||||||||||||||         |||||||||| |||||||||||| ||||||| ||    
7867129 ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaaattttttttgttgttttcggtccctgcaaattattttggtt 7867228  T
204 ttggaaatag 213  Q
    ||| ||||||    
7867229 ttgaaaatag 7867238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 19622655 - 19622767
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc-tgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||| |||          | |||||||||||||||||||||| |||||||    
19622655 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcccttgtaaaaaaaaaat-ttgtttttggtccctgcaaaattttttgtt 19622753  T
203 tttggaaatagtcc 216  Q
    |||| |||||||||    
19622754 tttgaaaatagtcc 19622767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 19721071 - 19720986
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
19721071 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 19720986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 22919684 - 22919796
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            ||||||||||||| |||||||| ||||||||    
22919684 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccttgcaaaattttttgttt 22919780  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
22919781 ttgaaaatagtccctg 22919796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 217
Target Start/End: Complemental strand, 26442899 - 26442786
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  |||||||||| || ||||||||||||||||||||          | |||||||||||||||||| ||| ||||||||    
26442899 ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcacaattttttgttt 26442800  T
204 ttggaaatagtccc 217  Q
    ||| ||||||||||    
26442799 ttgaaaatagtccc 26442786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 38150851 - 38150936
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
38150851 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaa 38150936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 98 - 219
Target Start/End: Complemental strand, 41358669 - 41358549
Alignment:
98 caaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatt 197  Q
    ||||| |||||||||||| |||| ||| |||||||||||||| |||||||||||||| ||||          |  |||||||||||||||||||||| ||    
41358669 caaataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg-gtaaaaaaatatttgtttttggtccctgcaaaatttt 41358571  T
198 ttgtttttggaaatagtccctg 219  Q
    ||| ||||| ||||||||||||    
41358570 ttggttttgaaaatagtccctg 41358549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 45368847 - 45368793
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||| ||||||||||||||| || ||||||||||||||||||||    
45368847 ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgt 45368793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 99 - 192
Target Start/End: Original strand, 47819227 - 47819320
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||| |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
47819227 aaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 47819320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 196
Target Start/End: Complemental strand, 8140799 - 8140707
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatat 196  Q
    |||||||||||| |||||||  ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||||||    
8140799 ggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatat 8140707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 10887233 - 10887321
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||| | |||||||||||||||||||          |||||||||||||||||||||||    
10887233 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 10887321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 19622950 - 19622905
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||||||||||||||| |||||||||||    
19622950 ttgtttttggtccctgcaaaatattttgtttttgaaaatagtccct 19622905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 24654167 - 24654079
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||| |||||          |||||||||||||||||||||||    
24654167 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgcaaaaaaaatttgttgtttttggtccctgcaaa 24654079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 174 - 219
Target Start/End: Original strand, 34492303 - 34492348
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||    
34492303 tgtttttggtccctgcaaaatattttgtttttgaaaatagtccctg 34492348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 4617091 - 4617202
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||||||| ||| |||||||| | ||||| ||||||||| ||||         || ||||||||||||| |||||||||||||||||||     
4617091 taaaatatggttttggtccctgaaaatatgtttcgttttagttttagtctctgtaaatttttgtttttgtttttggtccttgcaaaatattttgtttttc 4617190  T
207 gaaatagtccct 218  Q
     |||||||||||    
4617191 aaaatagtccct 4617202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 6567496 - 6567440
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
6567496 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 6567440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 18473272 - 18473386
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
18473272 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 18473370  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
18473371 ttgaaaatagtccctg 18473386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 21391096 - 21391152
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
21391096 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 21391152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 101 - 192
Target Start/End: Original strand, 24507476 - 24507567
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||| ||||| || ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
24507476 attggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 24507567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 194
Target Start/End: Original strand, 25658012 - 25658103
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||||| |||||||| | |||||||||||| |||||||||||| |||||||         |||||||||||||||||||||||||    
25658012 ttggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgt-aaaaaaatttgttgtttttggtccctgcaaaat 25658103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 31258339 - 31258454
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||| ||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
31258339 ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgttt 31258438  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
31258439 ttgaaaatagtccctg 31258454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 33045690 - 33045634
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||    
33045690 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 33045634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 35307715 - 35307830
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||| |||||          | ||||||||||||| || ||||| ||||||||    
35307715 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccttgtaaaattttttgttt 35307814  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
35307815 ttgaaaatagtccctg 35307830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 41881093 - 41881208
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| || ||||||||||| |||||||||||||||||||           | || ||||||||||||||||||  ||||||||    
41881093 ggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttatttttggtccctgcaaaaatttttgttt 41881192  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
41881193 ttgaaaatagtccctg 41881208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 101 - 192
Target Start/End: Original strand, 45638577 - 45638668
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
45638577 attggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 45638668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 48955714 - 48955826
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| || |||||||||||||||  |||          |  ||||||||||||||||||||| ||||||||    
48955714 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctttgttaaaaaaaaat--tgtttttggtccctgcaaaattttttgttt 48955811  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
48955812 ttgaaaatagtccct 48955826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 49923818 - 49923762
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||||||||||||||||||||  | |||||| |||||||||||||    
49923818 ggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgt 49923762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 170 - 218
Target Start/End: Original strand, 51986308 - 51986356
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||||||||||| |||||| |||||||||||    
51986308 ttgttgtttttggtccctgcaaaatattttatttttgaaaatagtccct 51986356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 3247352 - 3247313
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
3247352 ggtccctgcaaaatattttgtttttggaaatagtccctgc 3247313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 219
Target Start/End: Original strand, 4323829 - 4323943
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| ||||||||||| || |||||| |||||||| ||||          | |||||||| ||||||||||||| |||||||||    
4323829 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaaaataaaaattttgtttttagtccctgcaaaattttttgtttt 4323928  T
205 tggaaatagtccctg 219  Q
    || ||||||||||||    
4323929 tgaaaatagtccctg 4323943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 8140588 - 8140549
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
8140588 ggtccctgcaaaatattttgtttttggaaatagtccctgc 8140549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 10631528 - 10631473
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||    
10631528 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 10631473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 13260321 - 13260266
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||    
13260321 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 13260266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 24507689 - 24507728
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
24507689 ggtccctgcaaaatattttgtttttggaaatagtccctgc 24507728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 24653956 - 24653917
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
24653956 ggtccctgcaaaatattttgtttttggaaatagtccctgc 24653917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 33000459 - 33000420
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
33000459 ggtccctgcaaaatattttgtttttggaaatagtccctgc 33000420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 38151058 - 38151097
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
38151058 ggtccctgcaaaatattttgtttttggaaatagtccctgc 38151097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 38164141 - 38164180
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
38164141 ggtccctgcaaaatattttgtttttggaaatagtccctgc 38164180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 40718264 - 40718225
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
40718264 ggtccctgcaaaatattttgtttttggaaatagtccctgc 40718225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 45290457 - 45290512
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||    
45290457 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 45290512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 45380482 - 45380521
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
45380482 ggtccctgcaaaatattttgtttttggaaatagtccctgc 45380521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 47819442 - 47819481
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
47819442 ggtccctgcaaaatattttgtttttggaaatagtccctgc 47819481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 3247559 - 3247474
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
3247559 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa 3247474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 99 - 192
Target Start/End: Complemental strand, 16026943 - 16026850
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||| |||||||||||| |||||||| ||||||||||| ||  ||||||||||||||||||          |||||||||||||||||||||||    
16026943 aaataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaatttttttttgttgtttttggtccctgcaaa 16026850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 16060887 - 16060829
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||||||| ||||||||||| ||  |||||||||||||||||||    
16060887 ttggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt 16060829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 18899842 - 18899949
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||            |||||||||||||||||||||| |||||||||||    
18899842 taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaa---ttgtttttggtccctgcaaaat-ttttgtttttg 18899937  T
207 gaaatagtccct 218  Q
     |||||||||||    
18899938 aaaatagtccct 18899949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 20948753 - 20948811
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||||||| || ||||||||||| |||| |||||||||||||||    
20948753 ttggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgt 20948811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 26207280 - 26207334
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| ||||||||  ||||||||||||| ||||||||||||||||||||    
26207280 ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt 26207334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 99 - 192
Target Start/End: Complemental strand, 26324952 - 26324859
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||| ||||||||||||||||| |||  |||||||||| || ||||||||||||||| ||||         |||||||||||||||||||||||    
26324952 aaataggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaa 26324859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 159
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||| ||||||||  ||||||||||||| |||||||||||||||||||    
32420099 gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg 32420153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 32454222 - 32454176
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
32454222 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 32454176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 32626825 - 32626779
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
32626825 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 32626779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 37545695 - 37545741
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
37545695 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 37545741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 38163934 - 38164019
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
38163934 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 38164019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 99 - 192
Target Start/End: Complemental strand, 40718479 - 40718386
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||||| |||||||| |||||||||||  | |||||| ||||||||||||          |||||||||||||||||||||||    
40718479 aaattggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 40718386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 3679987 - 3679930
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||||| ||| ||||||||||| || |||||| |||||||||||||    
3679987 tggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt 3679930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 7001650 - 7001695
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||    
7001650 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccct 7001695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 217
Target Start/End: Complemental strand, 11822365 - 11822250
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt--nnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| |||||||||||||           || ||||||||||||| |||||||| ||||||    
11822365 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgtaaatttatttttttttgtttttggtccgtgcaaaattttttgt 11822266  T
202 ttttggaaatagtccc 217  Q
    ||||  ||||||||||    
11822265 tttttaaaatagtccc 11822250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 15526206 - 15526243
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||||||||||||||||||||    
15526206 ggtccctgcaaaatattttgtttttggaaatagtccct 15526243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 16083331 - 16083286
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||    
16083331 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccct 16083286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 155
Target Start/End: Complemental strand, 17984703 - 17984650
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||||||||||||| ||| ||||||||||| || |||||||||||||||    
17984703 ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 17984650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 100 - 219
Target Start/End: Original strand, 26191355 - 26191472
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatttt 199  Q
    |||||||||||||||| |||| ||| |||||||||||  | |||||||||||||||| |||          |  |||||||||||| |||||||| ||||    
26191355 aattggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaaat--tgtttttggtccttgcaaaatttttt 26191452  T
200 gtttttggaaatagtccctg 219  Q
    ||||||| ||||||||||||    
26191453 gtttttgaaaatagtccctg 26191472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 156
Target Start/End: Complemental strand, 26191735 - 26191682
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
26191735 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 26191682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 31061151 - 31061063
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||| || |||||||||| ||| |||||||||||||||||||          |||||||||||||||||||||||    
31061151 ggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 31061063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 32729049 - 32728938
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
32729049 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 32728951  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
32728950 ttgaaaatagtcc 32728938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 195
Target Start/End: Complemental strand, 32906237 - 32906149
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaata 195  Q
    ||||||||||||||||||  ||||||||||||| |||||| ||||||||  |||         ||||||||||||||||||||||||||    
32906237 taaaatatgattttggtccttgcaaatatgtctcgttttgattttagtcattgtaaaattcttttgttgtttttggtccctgcaaaata 32906149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 33379888 - 33380001
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||| |            |||||||||||||||||||||| ||||||||    
33379888 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctatgaaaaaaaa--attgtttttggtccctgcaaaattttttgttt 33379985  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
33379986 tttaaaatagtccctg 33380001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 219
Target Start/End: Original strand, 34383113 - 34383162
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||| |||||||||||||||||||| ||||||||||| ||||||||||||    
34383113 ttgtagtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 34383162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 34383245 - 34383188
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||||| ||  ||| |||||||| ||||||||||||||||||||||    
34383245 tggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctgt 34383188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 39747474 - 39747561
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||| |||| |||||||||||||||||||          |||||||||||||||||||||||    
39747474 ggctaaaatatggttttggtc-ctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 39747561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 44158042 - 44157954
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||| |         |||||||||||||||||||||||    
44158042 ggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccctataaaaaaaatttgttgtttttggtccctgcaaa 44157954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 46868579 - 46868522
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| ||||  || |||||||||||||| |||||||||||||||||||    
46868579 ttggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg 46868522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 1810927 - 1810983
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
1810927 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 1810983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 12361011 - 12361125
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||| || || ||||||||||||||||||||          | |||||||| ||||||||||||| ||||||||    
12361011 ggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaaaaaaaaagt-ttgtttttcgtccctgcaaaattttttgttt 12361109  T
204 ttggaaatagtccctg 219  Q
     || ||||||||||||    
12361110 atgaaaatagtccctg 12361125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 13259988 - 13260044
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
13259988 ggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgt 13260044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 204
Target Start/End: Complemental strand, 15058766 - 15058667
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  ||||| || |||||||||||||| |||||||||||||| | |||         ||||||||||||||||| ||||||||||||||||    
15058766 ggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttcatgtaaaaaaaa-ttgttgtttttggtcccggcaaaatattttgttt 15058668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 18302387 - 18302331
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
18302387 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 18302331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 19720864 - 19720828
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||||||||||||||||||    
19720864 ggtccctgcaaaatattttgtttttggaaatagtccc 19720828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 102 - 216
Target Start/End: Complemental strand, 29072864 - 29072749
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttg-ttgtttttggtccctgcaaaatattttg 200  Q
    |||||||||||||| |||| ||| ||||||||||| || | ||||||||||||||||||             |||||||||||||||||||||| |||||    
29072864 ttggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgtaaaaaaaaaaaaattgtttttggtccctgcaaaattttttg 29072765  T
201 tttttggaaatagtcc 216  Q
    |||||| |||||||||    
29072764 tttttgaaaatagtcc 29072749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 32626529 - 32626585
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||    
32626529 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 32626585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 33045355 - 33045411
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| || |||||||| ||||||||||| || ||||||||||||||||||||    
33045355 ggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgt 33045411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 33234546 - 33234602
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| ||  |||||||||||||||||||    
33234546 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt 33234602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 45368490 - 45368546
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
45368490 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 45368546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 48609594 - 48609538
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||| ||||    
48609594 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgt 48609538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 205
Target Start/End: Original strand, 3753214 - 3753310
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| |||||||||    
3753214 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaattttttgtttt 3753309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| |||||||||||||||  | |||||||||||||||||||    
12158690 ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg 12158745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 156
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||| |||||||| ||||||||||| || ||||||||||||||||    
15058419 gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc 15058470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 216
Target Start/End: Complemental strand, 16026728 - 16026693
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||||||||||||||||||||    
16026728 ggtccctgcaaaatattttgtttttggaaatagtcc 16026693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 153
Target Start/End: Complemental strand, 22953558 - 22953507
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttag 153  Q
    |||||||||||||| |||| ||| |||||||||||||| |||||||||||||    
22953558 ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag 22953507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 214
Target Start/End: Original strand, 26061956 - 26062066
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             || ||||||||||||||||||| ||||||||    
26061956 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattatttttggtccctgcaaaattttttgttt 26062055  T
204 ttggaaatagt 214  Q
    ||| |||||||    
26062056 ttgaaaatagt 26062066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 27521577 - 27521632
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||| ||| |||||||||||||| |||||| |||||||||||||    
27521577 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 27521632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 30323083 - 30323044
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||| ||||||||||||||||||||||||||||||||    
30323083 ggtccctacaaaatattttgtttttggaaatagtccctgc 30323044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 31060941 - 31060902
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||| ||||||||||||||||||||||||||||||||||    
31060941 ggtccttgcaaaatattttgtttttggaaatagtccctgc 31060902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 33045567 - 33045606
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||| |||||||||||||    
33045567 ggtccctgcaaaatattttgtttttgaaaatagtccctgc 33045606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 151
Target Start/End: Original strand, 34002635 - 34002682
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    ||||||| ||||||||||||| |||||||||||||| |||||||||||    
34002635 ggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt 34002682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 213
Target Start/End: Complemental strand, 35005744 - 35005634
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgtt-gtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||| ||          || || |||||||||||||||||||| |||||||    
35005744 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgcaaattttttttttttgtttttggtccctgcaaaattttttgtt 35005645  T
203 tttggaaatag 213  Q
    |||| ||||||    
35005644 tttgaaaatag 35005634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 35056684 - 35056645
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||| ||||||||||||||||||||||||||||||||    
35056684 ggtccctacaaaatattttgtttttggaaatagtccctgc 35056645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #159
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 39303675 - 39303730
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||| ||| |||||| ||||||| ||||||||||||||||||||    
39303675 gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgt 39303730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #160
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 216
Target Start/End: Original strand, 39747684 - 39747719
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||||||||||||||||||||    
39747684 ggtccctgcaaaatattttgtttttggaaatagtcc 39747719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #161
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 41358369 - 41358424
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
41358369 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 41358424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #162
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 218
Target Start/End: Original strand, 44641079 - 44641190
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| ||||||||||| || |||||||||||||||||| |            ||||||||||||| |||||||| |||||||||    
44641079 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaa--attgtttttggtccttgcaaaatgttttgtttt 44641176  T
205 tggaaatagtccct 218  Q
    || |||||||||||    
44641177 tgaaaatagtccct 44641190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #163
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 192
Target Start/End: Original strand, 46183686 - 46183772
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||| |||||||| |||||||||||  | ||||||||||||||||| ||         |||||||||||||||||||||||    
46183686 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccccgtaaaaaaaaattgttgtttttggtccctgcaaa 46183772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #164
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 1159840 - 1159726
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||| ||   ||||||| || |||||||||||||||||||||||         |  | ||||||| |||||||||||  |||||||    
1159840 tggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctgtaaaaaaaaat--tagtttttgatccctgcaaaaatttttgtt 1159743  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
1159742 tttgaaaatagtccctg 1159726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #165
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 7350733 - 7350648
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| ||||||||||  || |||||||||||||||| |||         |||||||||||||||||||||||    
7350733 taaaatatggttttggtcactgcaaatatacctcgttttggttttagtccttgtaatatttttttgttgtttttggtccctgcaaa 7350648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #166
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 152
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||| |||||||| |||||||||||||| ||||||||||||    
17130081 ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 17130035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #167
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 17984405 - 17984447
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||| ||||||||    
17984405 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtc 17984447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #168
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 18473595 - 18473541
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||    
18473595 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 18473541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #169
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 107 - 219
Target Start/End: Complemental strand, 18900130 - 18900021
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| ||||||||||     
18900130 taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaataaaaaa--attgtttttggtccctgcaaaattttttgttttt- 18900034  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
18900033 aaaatagtccctg 18900021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #170
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 20756087 - 20756133
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||||||    
20756087 ttgtttttggtccttgcaaaattttttgtttttgaaaatagtccctg 20756133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #171
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 103 - 215
Target Start/End: Complemental strand, 24510309 - 24510196
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct-gtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||| |||||||| |||||||||||  | ||||| |||||||| ||| ||         |||||||||||  ||| |||||||||||||||    
24510309 tggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagtacctagtaaaaaaaaattgttgtttttaatccttgcaaaatattttgt 24510210  T
202 ttttggaaatagtc 215  Q
    ||||| ||||||||    
24510209 ttttgaaaatagtc 24510196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #172
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 101 - 159
Target Start/End: Original strand, 24649347 - 24649405
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||||| |||| ||| ||||||||||| || ||||||||||||| |||||    
24649347 attggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg 24649405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #173
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 26142488 - 26142534
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||| ||||||||||| ||||||||||||    
26142488 ttgttttttgtccctgcaaaattttttgtttttgaaaatagtccctg 26142534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #174
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 26191657 - 26191611
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||||||    
26191657 ttgtttttggtccttgcaaaattttttgtttttgaaaatagtccctg 26191611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #175
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 110 - 218
Target Start/End: Original strand, 32035442 - 32035541
Alignment:
110 aatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttggaa 209  Q
    |||||| ||||| ||||||||||||||||| |||||||||||||||| |||           ||  |||||||||||| ||||||||||| |||||| ||    
32035442 aatatggttttgatctctgcaaatatgtctcgttttggttttagtccatgtga---------gtattttttggtccctacaaaatattttatttttgaaa 32035532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #176
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 99 - 145
Target Start/End: Complemental strand, 32035793 - 32035747
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgtttt 145  Q
    |||| |||||||||||| |||||||| ||||||||||||||||||||    
32035793 aaataggctaaaatatggttttggtccctgcaaatatgtcttgtttt 32035747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #177
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 32453996 - 32454042
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||| |||||||||||| ||||||||||| ||||||||||||    
32453996 ttgtttttgatccctgcaaaattttttgtttttgaaaatagtccctg 32454042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #178
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 41738794 - 41738852
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||||||| ||||||||||| ||  |||| ||||||||||||||    
41738794 ttggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgt 41738852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #179
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 45290752 - 45290706
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||| ||||    
45290752 ttgtttttggtccctgcaaaattttttgtttttgaaaatagttcctg 45290706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #180
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 52254481 - 52254423
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||| ||| ||||||||||| || |||||| |||||||||||||    
52254481 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 52254423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #181
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 3753572 - 3753463
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||| ||||||| || ||||||||||||||||||||            ||||||||||||| |||||||| ||||||||    
3753572 ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgtgaaaaaaaa--attgtttttggtccgtgcaaaattttttgttt 3753475  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
3753474 ttgaaaatagtc 3753463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #182
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 201
Target Start/End: Complemental strand, 4565336 - 4565240
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||| || ||||| |||||||||||||| |||||  |||||||||||||         |||||||||||||||| ||||||||| |||||    
4565336 ggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgt-aaatttttttgttgtttttggtccttgcaaaataatttgt 4565240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #183
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 200
Target Start/End: Original strand, 7350426 - 7350518
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||| |||| ||| ||||||||||||||  ||||||||||||||| | |         |||||||||||||||||||||||||||||||    
7350426 taaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttataaaaaaaa-ttgttgtttttggtccctgcaaaatattttg 7350518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #184
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 220
Target Start/End: Complemental strand, 7818930 - 7818885
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||||||||  ||| |||||||||    
7818930 gtttttggtccctgcaaaatattttgtttttaaaaaaagtccctgc 7818885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #185
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 10552245 - 10552204
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||| ||||||||||| |||||||    
10552245 ttgtttttggtccctgcaaaattttttgtttttgaaaatagt 10552204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #186
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 15516792 - 15516825
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagt 214  Q
    ||||||||||||||||||||||||||||||||||    
15516792 ggtccctgcaaaatattttgtttttggaaatagt 15516825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #187
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 16060596 - 16060683
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| || |||||||| || ||||||||||||||| ||||         |||||||||||||||||||||||    
16060596 ggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcactgtaaattttttttgttgtttttggtccctgcaaa 16060683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #188
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 31258634 - 31258589
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||| ||||| ||||||||||| |||||||||||    
31258634 ttgtttttggtccctgtaaaattttttgtttttgaaaatagtccct 31258589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #189
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 34808200 - 34808253
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||| ||| || ||||||||||| ||||||||||||||||||||    
34808200 taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgt 34808253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #190
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 3167384 - 3167483
Alignment:
1 tggttataagtatattactatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaa 100  Q
    |||||||||||||||||   || || ||||||||||||   ||||||||| | |||||| ||   ||||| || |||||||||||| |||||||||||||    
3167384 tggttataagtatatta---taagacagataaattatatatatttgcatagcttaactgattaccaaaaaggcatcaattactcttagtcatgaattcaa 3167480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #191
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 3679626 - 3679682
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| || |||||||| || ||||||||||||||||||||    
3679626 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 3679682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #192
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 11822004 - 11822056
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||    
11822004 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 11822056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #193
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 22919977 - 22919925
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||||||||||||||| || ||||| ||||||||||    
22919977 ggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc 22919925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #194
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 23288635 - 23288719
Alignment:
19 tatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    |||||||||||||||||| || ||| | |||||||||| || ||  ||||||    ||||||||||||| |||||||||||||||    
23288635 tatatgatagataaattacagacatctccataacataattgattactaaaaagaactcaattactcttgatcatgaattcaaatt 23288719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #195
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 32454294 - 32454238
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||| ||||||||||||    
32454294 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgt 32454238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #196
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 37545627 - 37545683
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||| |||| |||  |||||||||| || |||||||||||||||||||    
37545627 tggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg 37545683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #197
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 50799130 - 50799186
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| ||  |||||||||||||||||||    
50799130 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt 50799186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #198
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Original strand, 292926 - 292969
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||| ||||||||| ||||||||||| |||||||||    
292926 ttgtttttggtctctgcaaaattttttgtttttgaaaatagtcc 292969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #199
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 990088 - 990143
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| || |||||||| || |||||||||||||||||||    
990088 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg 990143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #200
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 1811104 - 1811069
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
1811104 ttgtagtttttggtccctgcaaaatattttgttttt 1811069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #201
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 2733351 - 2733386
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
2733351 ttgtagtttttggtccctgcaaaatattttgttttt 2733386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #202
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 3753378 - 3753413
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
3753378 ttgtagtttttggtccctgcaaaatattttgttttt 3753413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #203
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 5058736 - 5058790
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||||||  ||||||||||| | ||||| ||||||||||||||    
5058736 gctaaaatatgattttggtccatgcaaatatgt-tagttttagttttagtccctgt 5058790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #204
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 8364916 - 8364861
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||  |||||||| | |||||||||||| ||||||||||| |||||||    
8364916 ggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg 8364861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #205
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 10552146 - 10552111
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
10552146 ttgtagtttttggtccctgcaaaatattttgttttt 10552111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #206
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 10631318 - 10631279
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||| ||||||||||||||| |||||||||||||||||||    
10631318 ggtctctgcaaaatattttgattttggaaatagtccctgc 10631279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #207
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 12361178 - 12361213
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
12361178 ttgtagtttttggtccctgcaaaatattttgttttt 12361213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #208
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 13260153 - 13260188
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
13260153 ttgtagtttttggtccctgcaaaatattttgttttt 13260188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #209
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 14007654 - 14007689
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
14007654 ttgtagtttttggtccctgcaaaatattttgttttt 14007689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #210
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 17984529 - 17984494
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
17984529 ttgtagtttttggtccctgcaaaatattttgttttt 17984494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #211
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 18302216 - 18302181
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
18302216 ttgtagtttttggtccctgcaaaatattttgttttt 18302181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #212
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 18473439 - 18473474
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
18473439 ttgtagtttttggtccctgcaaaatattttgttttt 18473474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #213
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 19198948 - 19198893
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| ||||| |||||||||||||| ||  ||||| |||||||||||||    
19198948 gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgt 19198893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #214
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 19622823 - 19622858
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
19622823 ttgtagtttttggtccctgcaaaatattttgttttt 19622858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #215
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 19623017 - 19622962
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| ||||  || ||||||||||| || |||||||||||||||||||    
19623017 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 19622962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #216
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 20756186 - 20756221
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
20756186 ttgtagtttttggtccctgcaaaatattttgttttt 20756221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #217
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 216
Target Start/End: Complemental strand, 20948890 - 20948855
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||||||||||||||||| |||||||||    
20948890 ggtccctgcaaaatattttgtttttgaaaatagtcc 20948855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #218
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 21383269 - 21383304
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
21383269 ttgtagtttttggtccctgcaaaatattttgttttt 21383304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #219
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 22674203 - 22674254
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||||||| ||| ||||  ||||||||||||| |||||||||||||||    
22674203 ggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc 22674254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #220
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 26191525 - 26191560
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
26191525 ttgtagtttttggtccctgcaaaatattttgttttt 26191560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #221
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 26442733 - 26442698
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
26442733 ttgtagtttttggtccctgcaaaatattttgttttt 26442698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #222
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 30962416 - 30962471
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||   |||||| |||||||||||||  |||||||||||||||||||    
30962416 ggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg 30962471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #223
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 32420386 - 32420343
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||| | |||||||||||||||||| |||||||||    
32420386 ttgtttttggtccttacaaaatattttgtttttgaaaatagtcc 32420343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #224
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 32454123 - 32454088
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
32454123 ttgtagtttttggtccctgcaaaatattttgttttt 32454088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #225
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 32626726 - 32626691
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
32626726 ttgtagtttttggtccctgcaaaatattttgttttt 32626691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #226
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 33380054 - 33380089
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
33380054 ttgtagtttttggtccctgcaaaatattttgttttt 33380089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #227
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 35005444 - 35005499
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||| ||||||||||||    
35005444 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 35005499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #228
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 35005552 - 35005587
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
35005552 ttgtagtttttggtccctgcaaaatattttgttttt 35005587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #229
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 37545785 - 37545750
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
37545785 ttgtagtttttggtccctgcaaaatattttgttttt 37545750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #230
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 39303829 - 39303794
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
39303829 ttgtagtttttggtccctgcaaaatattttgttttt 39303794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #231
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 41881261 - 41881296
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
41881261 ttgtagtttttggtccctgcaaaatattttgttttt 41881296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #232
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 151
Target Start/End: Complemental strand, 42483271 - 42483224
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    |||||||||||| |||||||| |||||||||||  |||||||||||||    
42483271 ggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt 42483224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #233
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 45290624 - 45290659
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
45290624 ttgtagtttttggtccctgcaaaatattttgttttt 45290659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #234
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 45290820 - 45290765
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| | ||||||||| || |||||||||||||||||||    
45290820 ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg 45290765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #235
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 46183900 - 46183939
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||| |||||||| ||||    
46183900 ggtccctgcaaaatattttgtttttgaaaatagtctctgc 46183939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #236
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 46868394 - 46868429
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
46868394 ttgtagtttttggtccctgcaaaatattttgttttt 46868429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #237
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 48609428 - 48609393
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
48609428 ttgtagtttttggtccctgcaaaatattttgttttt 48609393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #238
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 50429043 - 50429008
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
50429043 ttgtagtttttggtccctgcaaaatattttgttttt 50429008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #239
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 52254348 - 52254383
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
52254348 ttgtagtttttggtccctgcaaaatattttgttttt 52254383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #240
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 52331603 - 52331568
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
52331603 ttgtagtttttggtccctgcaaaatattttgttttt 52331568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #241
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 2733252 - 2733294
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||| ||||||||| ||||||||||| ||||||||    
2733252 ttgtttttggtctctgcaaaattttttgtttttgaaaatagtc 2733294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #242
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 4324001 - 4324031
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
4324001 gtttttggtccctgcaaaatattttgttttt 4324031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #243
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 10631455 - 10631413
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||||||||||||  |||||||||| |||||||    
10631455 ttttggtctctgcaaatatgtctcattttggttttggtccctg 10631413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #244
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 11822212 - 11822250
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
11822212 ggtccctgcaaaattttttgtttttgaaaatagtccctg 11822250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #245
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 156
Target Start/End: Original strand, 12322602 - 12322656
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||||| ||||| || |||||||||||| | |||||| |||||||||    
12322602 ttggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtcc 12322656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #246
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 14007803 - 14007761
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||| ||||||||||  ||||||||||||    
14007803 ttttggtccctgcaaaattttttgttttttaaaatagtccctg 14007761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #247
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 15334985 - 15335031
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||  |||||||||| ||||||||||| ||||||||||||    
15334985 ttgtttttgggtcctgcaaaattttttgtttttgaaaatagtccctg 15335031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #248
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 16083120 - 16083166
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||| ||||||||||  ||||||||||||    
16083120 ttgtttttagtccctgcaaaattttttgttttttaaaatagtccctg 16083166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #249
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 17129691 - 17129745
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| ||||| |  ||||||||||| || ||||||||||||||||||||    
17129691 ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgt 17129745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #250
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 160
Target Start/End: Original strand, 18302075 - 18302109
Alignment:
126 ctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| ||||||||||||||||||||    
18302075 ctgcaaatatgtctcgttttggttttagtccctgt 18302109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #251
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 21391309 - 21391263
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||| ||||||||  ||||||||||| ||||||||||||    
21391309 ttgtttttggtctctgcaaaaatttttgtttttgaaaatagtccctg 21391263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #252
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 204
Target Start/End: Original strand, 24649517 - 24649551
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    |||| ||||||||||||||||||||||||||||||    
24649517 ttgtagtttttggtccctgcaaaatattttgtttt 24649551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #253
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| |||||||||||||| ||||||||||| |||||||    
26324874 ttttggtccctgcaaatatgtctcgttttggttttcgtccctg 26324832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #254
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 29688364 - 29688322
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||  ||||||||    
29688364 ttgtttttggtccctgcaaaattttttgttttttaaaatagtc 29688322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #255
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 29688428 - 29688374
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| ||||  || ||||||||||| || ||||||||||||||||||    
29688428 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct 29688374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #256
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 31258549 - 31258587
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
31258549 ggtccctgcaaaattttttgtttttgaaaatagtccctg 31258587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #257
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 145
Target Start/End: Original strand, 31404429 - 31404467
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgtttt 145  Q
    |||||||||||||||||| |||||||||||||| |||||    
31404429 taaaatatgattttggtccctgcaaatatgtctcgtttt 31404467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #258
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 33380186 - 33380144
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||| ||||||||||| ||||| |||||    
33380186 tttttggtccctgcaaaattttttgtttttgaaaatattccct 33380144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #259
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 49226445 - 49226483
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
49226445 ggtccctgcaaaattttttgtttttgaaaatagtccctg 49226483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #260
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 1811062 - 1811025
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
1811062 ggtccctgcaaaattttttgtttttgaaaatagtccct 1811025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #261
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 3679919 - 3679874
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||| | ||||||||||| |||||||||||    
3679919 ttgtttttggtcccggcaaatttttttgtttttgaaaatagtccct 3679874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #262
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 152
Target Start/End: Original strand, 4360299 - 4360343
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    ||||||||| |||| ||| |||||||||||||||||||||||||||    
4360299 taaaatatggttttagtc-ctgcaaatatgtcttgttttggtttta 4360343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #263
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 12360603 - 12360691
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| ||  |||| ||||||| ||||||         |||||||||||| ||||||||||    
12360603 ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgtaattattttttgttgtttttgatccctgcaaa 12360691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #264
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 12361220 - 12361257
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
12361220 ggtccctgcaaaattttttgtttttgaaaatagtccct 12361257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #265
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 13770698 - 13770735
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
13770698 ggtccctgcaaaattttttgtttttgaaaatagtccct 13770735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #266
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 17984628 - 17984587
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||| ||||| ||||||||||| |||||||    
17984628 ttgtttttggtccctgtaaaattttttgtttttgaaaatagt 17984587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #267
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 206
Target Start/End: Original strand, 29579322 - 29579422
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||| |||  |||||||||| ||  ||||  |||||||||||||         |||||||||||| ||||||||||||||||||| |||    
29579322 ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgtaaaaaaaatttgttgtttttgatccctgcaaaatattttgtattt 29579421  T
206 g 206  Q
    |    
29579422 g 29579422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #268
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 35005594 - 35005631
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
35005594 ggtccctgcaaaattttttgtttttgaaaatagtccct 35005631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #269
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 35307901 - 35307864
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
35307901 ggtccctgcaaaattttttgtttttgaaaatagtccct 35307864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #270
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 156
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||| |||||||| |||||||||||||| |||||| |||| ||||    
39025112 taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc 39025161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #271
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 42483121 - 42483088
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||||||| |||||||    
42483121 ggtccctgcaaaatattttgtttttgaaaatagt 42483088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #272
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 45290666 - 45290703
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
45290666 ggtccctgcaaaattttttgtttttgaaaatagtccct 45290703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #273
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 45368558 - 45368603
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||| |||||||||| ||||||||||  |||||||||||    
45368558 ttgtttttggttcctgcaaaattttttgttttttaaaatagtccct 45368603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #274
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 49226530 - 49226485
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||| | |||||||||| ||||||||||| |||||||||||    
49226530 ttgtttttgattcctgcaaaattttttgtttttgaaaatagtccct 49226485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #275
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 4360626 - 4360570
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| |||  |||||||| ||||||    
4360626 ggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgt 4360570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #276
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 4617395 - 4617339
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||||||  |  ||||||||| | ||||||||||||||| ||||    
4617395 ggctaaaatatgattttggttccaacaaatatgtttcgttttggttttagtctctgt 4617339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #277
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 4941710 - 4941794
Alignment:
19 tatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    ||||||| | |||||||||||  ||||| ||| | |||||| ||   ||||| || ||||||| |||||||||||||||||||||    
4941710 tatatgacaaataaattatagatatttgaatagcttaactgattacaaaaaatgcatcaattattcttggtcatgaattcaaatt 4941794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #278
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 217
Target Start/End: Original strand, 10552033 - 10552073
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||| |||| |||||| ||||||||||    
10552033 ttttggtccctgcaaaattttttatttttgaaaatagtccc 10552073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #279
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 13260194 - 13260230
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||| ||||||||||| ||||||||||    
13260194 ggtccctgcaaaattttttgtttttgaaaatagtccc 13260230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #280
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 159
Target Start/End: Complemental strand, 15211859 - 15211803
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||| ||||||||  |||||||||| || |||||||||| | ||||||    
15211859 tggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg 15211803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #281
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 17984333 - 17984389
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||  ||| ||||||||||| || ||||||||||||||| ||||    
17984333 ggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgt 17984389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #282
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 17984487 - 17984451
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||| ||||||||||| ||||||||||    
17984487 ggtccctgcaaaattttttgtttttgaaaatagtccc 17984451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #283
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 18079398 - 18079454
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| | ||||||||  |||||||||| ||  |||||||||||||||||||    
18079398 ggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgt 18079454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #284
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 21486004 - 21485968
Alignment:
23 tgatagataaattatagtcatttgcataacataactg 59  Q
    ||||||||||||||||| |||||||||||| ||||||    
21486004 tgatagataaattatagacatttgcataacttaactg 21485968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #285
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 218
Target Start/End: Original strand, 22674388 - 22674420
Alignment:
186 ctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||| |||||||||||    
22674388 ctgcaaaatattttgtttttgaaaatagtccct 22674420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #286
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 24649656 - 24649604
Alignment:
108 aaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||| |||| |||  |||||||||| || ||||||||||||||||||||    
24649656 aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 24649604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #287
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||| |||| ||| ||||||||||| || ||||| |||||||||||||    
31258699 taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg 31258647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #288
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 33067348 - 33067400
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| |||  ||||||||||||| ||||||||||| ||||    
33067348 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc 33067400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #289
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 48609385 - 48609349
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||| ||||||||||| ||||||||||    
48609385 ggtccctgcaaaattttttgtttttgaaaatagtccc 48609349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #290
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 52254183 - 52254235
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| ||||  || ||||||||||| || ||||||||||||||||    
52254183 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc 52254235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 232)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 2728232 - 2728348
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
2728232 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgttt 2728331  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
2728332 ttggaaatagtccctgc 2728348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 98 - 220
Target Start/End: Complemental strand, 35347004 - 35346882
Alignment:
98 caaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatt 197  Q
    ||||| |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||    
35347004 caaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatatt 35346905  T
198 ttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||    
35346904 ttgtttttggaaatagtccctgc 35346882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 104 - 217
Target Start/End: Original strand, 10337119 - 10337232
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
10337119 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 10337218  T
204 ttggaaatagtccc 217  Q
    ||||||||||||||    
10337219 ttggaaatagtccc 10337232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 35097323 - 35097444
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||||||||    
35097323 aaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt 35097422  T
199 tgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||    
35097423 tgtttttggaaatagtccctgc 35097444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 32725907 - 32726023
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
32725907 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgttt 32726006  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
32726007 ttggaaatagtccctgc 32726023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 34963666 - 34963548
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          || |||||||||||||||||||||||||||||    
34963666 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttattgtttttggtccctgcaaaatattttgt 34963567  T
202 ttttggaaatagtccctgc 220  Q
    |||||||||||||||||||    
34963566 ttttggaaatagtccctgc 34963548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 7420590 - 7420474
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||||||| |    
7420590 ggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtct 7420491  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
7420490 ttggaaatagtccctgc 7420474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 20984510 - 20984394
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| || ||||||||||| ||||||||||||||||||||         ||||||||||||||||| ||||||||||||||||    
20984510 ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgttt 20984411  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
20984410 ttggaaatagtccctgc 20984394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 28346394 - 28346510
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
28346394 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatattttgttt 28346493  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
28346494 ttggaaatagtccctgc 28346510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 37536086 - 37536202
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
37536086 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttgttt 37536185  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
37536186 ttggaaatagtccctgc 37536202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 9175012 - 9175126
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||||||||||||  ||||||||||||| ||||||||||||||||||||         ||||||||||||||||| ||||||||||||||||    
9175012 ggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtcccagcaaaatattttgttt 9175111  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
9175112 ttgaaaatagtccct 9175126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 9496341 - 9496453
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||| ||||          ||||||||||||||||||||||||||||||||||    
9496341 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattttgttt 9496440  T
204 ttggaaatagtcc 216  Q
    |||||||||||||    
9496441 ttggaaatagtcc 9496453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 104 - 211
Target Start/End: Complemental strand, 8298975 - 8298868
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
8298975 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 8298876  T
204 ttggaaat 211  Q
    ||| ||||    
8298875 ttgaaaat 8298868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 3511906 - 3512018
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| || |||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
3511906 ggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 3512005  T
204 ttggaaatagtcc 216  Q
    |||||||||||||    
3512006 ttggaaatagtcc 3512018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 99 - 215
Target Start/End: Original strand, 5357418 - 5357534
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| ||||||||||||||||||||| ||||||||||| || |||||||||||||||||| |         |||||||||||||| ||||||||||||||    
5357418 aaataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctataaaaaaattttgttgtttttggttcctgcaaaatattt 5357517  T
199 tgtttttggaaatagtc 215  Q
    |||||||| ||||||||    
5357518 tgtttttgaaaatagtc 5357534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 10872915 - 10873031
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || ||||||||||| || ||||||||||||||||||||         ||||||||||| ||||||||||||||||||||||    
10872915 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaaaaataatttgttgtttttagtccctgcaaaatattttgttt 10873014  T
204 ttggaaatagtccctgc 220  Q
    ||| |||||||||||||    
10873015 ttgaaaatagtccctgc 10873031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 107 - 219
Target Start/End: Complemental strand, 28497616 - 28497504
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||||||||| ||||||||||| || ||||||||||||||||||||          |||||||||||||||||| |||||||||||||||||    
28497616 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaatttttatgttgtttttggtccctgaaaaatattttgtttttg 28497517  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
28497516 aaaatagtccctg 28497504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 11976373 - 11976488
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | |||    
11976373 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa-ttgttgtttttggtccctgcaaaatattattttt 11976471  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
11976472 ttggaaatagtccctgc 11976488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 7326422 - 7326304
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttg-ttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||  |||||||||||||||| ||||||||||||    
7326422 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaatttttttttattgtttttggtccctgtaaaatattttgt 7326323  T
202 ttttggaaatagtccctgc 220  Q
    |||||||||||||||||||    
7326322 ttttggaaatagtccctgc 7326304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 25600597 - 25600480
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttg-tttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||  |||||||| |||||||||||||||||||||||||||||||||||         |||||| ||||| |||| ||||||||||||| ||    
25600597 ggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaaaaaaaattgttgtttttttgtccttgcaaaatattttatt 25600498  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
25600497 tttggaaatagtccctgc 25600480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 25702512 - 25702628
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||| ||||||| || |||||  |||||||||||||         |||||||||||||||| |||||||||||||||||    
25702512 ggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgtaagaaaaaattgttgtttttggtccatgcaaaatattttgttt 25702611  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
25702612 ttggaaatagtccctgc 25702628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 105 - 216
Target Start/End: Complemental strand, 24090487 - 24090376
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||||||| ||||||||||| || ||||||||||||||| ||||         |||||||||||||||||| ||||||||||||||||    
24090487 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaattgttgtttttggtccctacaaaatattttgtttt 24090388  T
205 tggaaatagtcc 216  Q
    || |||||||||    
24090387 tgaaaatagtcc 24090376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 105 - 207
Target Start/End: Original strand, 15930933 - 15931035
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    |||||||||||||||||||  || ||||||||||| ||||||||||||||||||||         |||||||||||||||| ||||||||||||||||||    
15930933 gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccttgcaaaatattttgtttt 15931032  T
205 tgg 207  Q
    |||    
15931033 tgg 15931035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 104 - 214
Target Start/End: Complemental strand, 10540782 - 10540670
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnn--ttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||| |||||||| |||||||||||  | ||||||||||||||||||||           ||||||||||||||||||||||||||||||||    
10540782 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaaattgttgtttttggtccctgcaaaatattttgt 10540683  T
202 ttttggaaatagt 214  Q
    |||||||||||||    
10540682 ttttggaaatagt 10540670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 106 - 219
Target Start/End: Original strand, 13779151 - 13779264
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| ||||| || |||||||||||||| |||||||||||| |||||||          |||||||||||||| ||||||||||||||||||||    
13779151 ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgtaaaaaaaaaatgttgtttttggtctctgcaaaatattttgttttt 13779250  T
206 ggaaatagtccctg 219  Q
    | ||||||||||||    
13779251 gaaaatagtccctg 13779264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 102 - 194
Target Start/End: Complemental strand, 42133156 - 42133064
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||||||||    
42133156 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaat 42133064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 107 - 218
Target Start/End: Complemental strand, 14848186 - 14848076
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||||||||  || |||||||||||||| ||||||||||||||||| ||          ||||||||||||||||||||||||||||||||||||    
14848186 taaaatatgattttaatc-ctgcaaatatgtctcgttttggttttagtccccgtaaaatttttgtgttgtttttggtccctgcaaaatattttgtttttg 14848088  T
207 gaaatagtccct 218  Q
     |||||||||||    
14848087 aaaatagtccct 14848076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 20278057 - 20277946
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||| ||||| || |||||||||||||||| |||         |||||||||||||||||| |||||||||||||||    
20278057 ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaatttttttttgttgtttttggtccctccaaaatattttgttt 20277958  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
20277957 ttgaaaatagtc 20277946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 21064684 - 21064573
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||| ||||| || |||||||||||||||| |||         |||||||||||||||||| |||||||||||||||    
21064684 ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaatttttttttgttgtttttggtccctccaaaatattttgttt 21064585  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
21064584 ttgaaaatagtc 21064573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 103 - 192
Target Start/End: Original strand, 8298586 - 8298675
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||||||    
8298586 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 8298675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 17073807 - 17073918
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||||||  |||||||||||||||||||         || |||||||| ||||||||||||||||||||||    
17073807 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt--aattttttttttgttttt-gtccctgcaaaatattttgttt 17073903  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
17073904 ttgaaaatagtccct 17073918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 17574463 - 17574352
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||||||  |||||||||||||||||||         || |||||||| ||||||||||||||||||||||    
17574463 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt--aattttttttttgttttt-gtccctgcaaaatattttgttt 17574367  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
17574366 ttgaaaatagtccct 17574352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 200
Target Start/End: Complemental strand, 4710220 - 4710124
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||||||||||    
4710220 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 4710124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 6469280 - 6469392
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||  ||| ||| ||||||||||| || |||||||||||||| |||||         ||||||||||||||||||||||||||||||| ||    
6469280 ggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgctt 6469379  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
6469380 ttgaaaatagtcc 6469392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 107 - 215
Target Start/End: Complemental strand, 13796593 - 13796485
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| ||| | || ||||||||||||||  |||||||||||||||||||         |||||||||||||||||||||||||||||||||||||    
13796593 taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttgtttttg 13796494  T
207 gaaatagtc 215  Q
     | ||||||    
13796493 aacatagtc 13796485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 99 - 218
Target Start/End: Original strand, 29487745 - 29487862
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||||||||||||||||||||| ||| |||||||||||| | |||||||||||||||| |||            |||||||||||||||||||||| |||    
29487745 aaattggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtccatgtgaaaaaaaa--attgtttttggtccctgcaaaattttt 29487842  T
199 tgtttttggaaatagtccct 218  Q
    |||||||| |||||||||||    
29487843 tgtttttgaaaatagtccct 29487862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 8094479 - 8094594
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||||||||||||||||| |||||||||||||||||||             | |||||||||||||||||||| ||||||||    
8094479 ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattcgtttttggtccctgcaaaattttttgttt 8094578  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
8094579 ttgaaaatagtccctg 8094594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 9832215 - 9832326
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||| |||| ||||||||  ||||||||||| |||||||||||||| |||||||         |||||||||||||||||| |||||||||||||||    
9832215 ggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgtaaaaaaag-ttgttgtttttggtcccttcaaaatattttgttt 9832313  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
9832314 ttgaaaatagtcc 9832326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 102 - 219
Target Start/End: Complemental strand, 14489075 - 14488961
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||            ||||||||||||| | |||||| ||||||    
14489075 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccgtacaaaattttttgt 14488979  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
14488978 ttttgaaaatagtccctg 14488961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 27341591 - 27341480
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | || ||||||||||||||||||||||||||||    
27341591 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttatttttggtccctgcaaaatattttgttt 27341492  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
27341491 ttgaaaatagtc 27341480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 100 - 159
Target Start/End: Original strand, 1778560 - 1778619
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
1778560 aattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1778619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 7272420 - 7272534
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||| ||||          | ||||||||||||||||| ||||| |||||||    
7272420 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaagaaaattttgtttttggtccctgctaaataatttgttt 7272519  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
7272520 ttgaaaatagtccct 7272534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 13155251 - 13155137
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||  |||||||||||||| |||||||||||| |||||||         || ||||||||| |||||||||||||||||||||    
13155251 ggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaattattgtttttgatccctgcaaaatattttgttt 13155152  T
204 ttggaaatagtccct 218  Q
    ||  |||||||||||    
13155151 ttaaaaatagtccct 13155137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 16644044 - 16643930
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||           | |||||||||||||||||||||| ||||||||    
16644044 ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggtaaaacaaaattttgtttttggtccctgcaaaattttttgttt 16643945  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
16643944 ttgaaaatagtccct 16643930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 22650464 - 22650581
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnt--tgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| |||||||||||||         |  | |||||||||||||||||||||| ||||||    
22650464 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaataatattgtttttggtccctgcaaaattttttgt 22650563  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
22650564 ttttgaaaatagtccctg 22650581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 7186006 - 7185948
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||    
7186006 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 7185948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 13232563 - 13232447
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| ||||||||||| ||  ||||||||||||| | |||         ||||| ||||||||||||| |||||||||||||    
13232563 tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttc-tgtaaattttttttgttatttttggtccctgaaaaatattttgtt 13232465  T
203 tttggaaatagtccctgc 220  Q
    |||| |||||||||||||    
13232464 tttgaaaatagtccctgc 13232447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 103 - 192
Target Start/End: Original strand, 35346628 - 35346717
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
35346628 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 35346717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 3512266 - 3512178
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
3512266 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 3512178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 10873282 - 10873225
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| |||||||||||||||||||| || |||||||||||||||||||    
10873282 ttggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg 10873225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 11019520 - 11019608
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
11019520 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 11019608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 20984146 - 20984234
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||    
20984146 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 20984234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 28399035 - 28398926
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| |||||||||||  | ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
28399035 ggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgtaaaaaaa-----ttgtttttggtccctgcaaaattttttgttt 28398941  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
28398940 ttgaaaatagtccct 28398926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 117 - 220
Target Start/End: Complemental strand, 1778916 - 1778813
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||| |||||||||||||| |||||||||||| |||||||         |||||||||||| |||||| ||||||| ||||||||| ||||| |||    
1778916 ttttggtccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaattttgttgtttttgttccctgtaaaatatattgtttttgaaaataatcc 1778817  T
217 ctgc 220  Q
    ||||    
1778816 ctgc 1778813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 28323849 - 28323963
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| || | ||| |||||||||||  | |||||||||||||||||| |         ||||||||||||||||||||||||||||||||||    
28323849 ggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct-ttaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 28323947  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||| ||||    
28323948 ttgaaaatagttcctg 28323963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 28324181 - 28324125
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| || ||||||||||||||||||||||||||||||||    
28324181 ggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgt 28324125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 29158354 - 29158465
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||            ||||||||| |||||||||||| ||||||||    
29158354 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaataaaatttgtttttgatccctgcaaaattttttgttt 29158453  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
29158454 ttgaaaatagtc 29158465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 107 - 214
Target Start/End: Original strand, 33652193 - 33652300
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||||| ||| ||||||||||| || ||||| ||||||||  ||||         |||||||||||||||||||||||||||||| ||||||    
33652193 taaaatatgattttagtccctgcaaatatgcctcgttttagttttagtttctgtaaattttttttgttgtttttggtccctgcaaaatattttatttttg 33652292  T
207 gaaatagt 214  Q
     |||||||    
33652293 aaaatagt 33652300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 38930664 - 38930549
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| || |||||||||||| ||||||             |||||||||||||||||||||| ||||||||    
38930664 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 38930565  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
38930564 ttgaaaatagtccctg 38930549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 40492960 - 40493067
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||  |||||||||||||| ||||||||||||||||||||          | || ||||||||||||||||||| ||||||||    
40492960 ggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgtaa--------ttttttttttggtccctgcaaaattttttgttt 40493051  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
40493052 ttgaaaatagtccctg 40493067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 102 - 219
Target Start/End: Original strand, 40844154 - 40844268
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||         ||||   |||||||||||||||||| ||||||    
40844154 ttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaattgt---ttttggtccctgcaaaattttttgt 40844250  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
40844251 ttttgaaaatagtccctg 40844268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 2728599 - 2728509
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
2728599 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 2728509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 4375691 - 4375804
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| ||||||||||| || |||||||||||| |||||||         ||||   |||||||||||||||||| |||||||    
4375691 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaaaaaattgt---ttttggtccctgcaaaattttttgtt 4375787  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
4375788 tttgaaaatagtccctg 4375804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 105 - 219
Target Start/End: Complemental strand, 6146948 - 6146834
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||          | |||||||||||||||||||| | |||||||||    
6146948 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaatttttttgtttt 6146849  T
205 tggaaatagtccctg 219  Q
    || ||||||||||||    
6146848 tgaaaatagtccctg 6146834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 7420230 - 7420285
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
7420230 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 7420285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 24187897 - 24187842
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||    
24187897 ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg 24187842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 33526412 - 33526303
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||             ||||||||||||||||||||| ||||||||    
33526412 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaa---atgtttttggtccctgcaaaattttttgttt 33526316  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
33526315 ttgaaaatagtcc 33526303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 35097694 - 35097604
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
35097694 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 35097604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 101 - 218
Target Start/End: Original strand, 10776145 - 10776261
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||| |||||||||| |||| ||| |||||||||||||| |||||||||||| ||| |||         || |||||||||||||||||||||| |||||    
10776145 attgtctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaattttttttt-ttgtttttggtccctgcaaaattttttg 10776243  T
201 tttttggaaatagtccct 218  Q
    |||||| ||||| |||||    
10776244 tttttgaaaatattccct 10776261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 11976733 - 11976648
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
11976733 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaa 11976648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 13232201 - 13232286
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||| |||||||||||    
13232201 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaatattttgttgtttttagtccctgcaaa 13232286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 98 - 219
Target Start/End: Original strand, 19494113 - 19494233
Alignment:
98 caaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatt 197  Q
    ||||| |||||||||||| |||| ||| |||||||||||||| |||||||||||||| ||||          |  |||||||||||||||||||||| ||    
19494113 caaataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg-gtaaaaaaatatttgtttttggtccctgcaaaatttt 19494211  T
198 ttgtttttggaaatagtccctg 219  Q
    ||| ||||| ||||||||||||    
19494212 ttggttttgaaaatagtccctg 19494233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 100 - 216
Target Start/End: Complemental strand, 10776503 - 10776387
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatttt 199  Q
    |||||||||||||||| |||| ||| ||||||||||| || |||||||||||||| |||||            |||||||| ||||||||||||| ||||    
10776503 aattggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaaattgttttttgtccctgcaaaatttttt 10776404  T
200 gtttttggaaatagtcc 216  Q
    ||||||| |||||||||    
10776403 gtttttgaaaatagtcc 10776387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 11019857 - 11019769
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
11019857 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 11019769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 219
Target Start/End: Complemental strand, 14495233 - 14495184
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||| |||||||||||||||||||||||||||||||| ||||||||||||    
14495233 ttgtagtttttggtccctgcaaaatattttgtttttgaaaatagtccctg 14495184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 28346758 - 28346670
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
28346758 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaa 28346670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 32726271 - 32726183
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
32726271 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 32726183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 33636317 - 33636437
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||| |||||||||||  | ||||||||||||||||| |           | |||||||||||||||||||||| |||    
33636317 aaataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccccggtaaaaaaaaattttgtttttggtccctgcaaaattttt 33636416  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||    
33636417 tgtttttgaaaatagtccctg 33636437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 34963300 - 34963388
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
34963300 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa 34963388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 42132862 - 42132919
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| |||||||| |||||||||||||| |||||||||||| ||||||    
42132862 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg 42132919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 1525809 - 1525924
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||| |||             |||||||||||||||||||||| ||||||||    
1525809 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctggcaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 1525908  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
1525909 ttgaaaatagtccctg 1525924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 6469667 - 6469611
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||||||| ||||||||||||   ||||||||||||||||||||    
6469667 ggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgt 6469611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 14238751 - 14238807
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
14238751 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 14238807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 25600230 - 25600286
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||| |||||    
25600230 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgt 25600286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 200
Target Start/End: Original strand, 27117753 - 27117848
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||||||||| ||||| || |||||||||||||| |||||| |||||||||||||         |||||||||||||||||||||||| ||||||    
27117753 ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaagattttg 27117848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 38930302 - 38930416
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||| |||||||||| |||||||||||||| ||||           | |||||||||||||||||||||| ||||||||    
38930302 ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggtaaaaaaaaat-ttgtttttggtccctgcaaaattttttgttt 38930400  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
38930401 ttgaaaatagtccctg 38930416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 215
Target Start/End: Complemental strand, 40066822 - 40066712
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| ||||||||||| |  ||||||||||||||||||||         |||||   ||||||||||||||||| ||||||    
40066822 ttggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgtaaaaaaaatttgtt---tttggtccctgcaaaattttttgt 40066726  T
202 ttttggaaatagtc 215  Q
    ||||| ||||||||    
40066725 ttttgaaaatagtc 40066712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 1778775 - 1778814
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
1778775 ggtccctgcaaaatattttgtttttggaaatagtccctgc 1778814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 109 - 218
Target Start/End: Original strand, 3680532 - 3680642
Alignment:
109 aaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnn-ttgttgtttttggtccctgcaaaatattttgtttttgg 207  Q
    ||||||| ||||| || ||||||||||| || ||||||||||||||||||||          || |||||||| |||||||||||||||||||||||||     
3680532 aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgtaatttttttgtttttgttttttgtccctgcaaaatattttgtttttga 3680631  T
208 aaatagtccct 218  Q
    |||| ||||||    
3680632 aaatcgtccct 3680642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 4473704 - 4473759
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| ||||||||| |||| |||||||||||||||||||    
4473704 ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 4473759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 4473915 - 4473954
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
4473915 ggtccctgcaaaatattttgtttttggaaatagtccctgc 4473954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 11976526 - 11976487
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
11976526 ggtccctgcaaaatattttgtttttggaaatagtccctgc 11976487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 14239080 - 14238967
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||| | ||||||||    
14239080 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaa-aattgtttttggtccctgcaaatttttttgttt 14238982  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
14238981 ttgaaaatagtccct 14238967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 206
Target Start/End: Original strand, 16643661 - 16643762
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| ||||||||||||||||||||||           | |||||||||||||||||||||| ||||||||    
16643661 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggtaaaaaaaaat-ttgtttttggtccctgcaaaattttttgttt 16643759  T
204 ttg 206  Q
    |||    
16643760 ttg 16643762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 28346548 - 28346509
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
28346548 ggtccctgcaaaatattttgtttttggaaatagtccctgc 28346509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 32726061 - 32726022
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
32726061 ggtccctgcaaaatattttgtttttggaaatagtccctgc 32726022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 34963510 - 34963549
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
34963510 ggtccctgcaaaatattttgtttttggaaatagtccctgc 34963549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 35097482 - 35097443
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
35097482 ggtccctgcaaaatattttgtttttggaaatagtccctgc 35097443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 37536421 - 37536331
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
37536421 ttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 37536331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 194
Target Start/End: Original strand, 44997931 - 44998021
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    ||||||||||||||||||||| ||||||||||| || |||||| ||||| | |||||         |||||||||||||||||||||||||    
44997931 ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgtaaattttttttgttgtttttggtccctgcaaaat 44998021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 44998265 - 44998176
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| ||||| ||||| ||||||||||| |||||||||||||| |||||         |||||||||||||||||||||||    
44998265 ttggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagt-cctgtaaaaaaaaattgttgtttttggtccctgcaaa 44998176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 3512056 - 3512018
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||||||||||||||||    
3512056 ggtccctgcaaaatattttgtttttggaaatagtccctg 3512018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 103 - 192
Target Start/End: Complemental strand, 4621355 - 4621266
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||  |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||| ||||||||    
4621355 tggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaataatttgttgtttttggttcctgcaaa 4621266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 158
Target Start/End: Original strand, 10540449 - 10540503
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||  |||||||||||||||||||| || ||||||||||||||||||    
10540449 ggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct 10540503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 18549571 - 18549517
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
18549571 ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgt 18549517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 100 - 154
Target Start/End: Original strand, 23939543 - 23939597
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||||||| |||||||| |||||||||||||| ||||| ||||||||    
23939543 aattggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt 23939597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 32195348 - 32195390
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||||||||||||||| ||||||||    
32195348 ttgtttttggtccctgcaaaatattttgtttttgaaaatagtc 32195390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 33636617 - 33636571
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
33636617 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 33636571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 182 - 220
Target Start/End: Complemental strand, 37536239 - 37536201
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||||||||||||||||    
37536239 gtccctgcaaaatattttgtttttggaaatagtccctgc 37536201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 198
Target Start/End: Complemental strand, 7272753 - 7272657
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||||||||||||| |||| | | ||||||||||| || ||||||||||||||||||||         || ||||||||||||||||||||| ||||    
7272753 ttggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaaacaaaattttttgtttttggtccctgcaaaaaattt 7272657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 7326086 - 7326174
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||||||  |||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
7326086 ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa 7326174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 9496723 - 9496635
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
9496723 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 9496635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 10337449 - 10337361
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || ||||| |||||||||||||          |||||||||||||||||||||||    
10337449 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 10337361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 14495069 - 14495180
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||| |||||            |||||||||||||||||||||| ||||||||    
14495069 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 14495167  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
14495168 ttgaaaatagtcc 14495180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 16789370 - 16789313
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
16789370 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 16789313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 24815068 - 24814980
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||| | ||||||||||||||  |||||||||||||||||||         || ||||||||||||||||||||    
24815068 ggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaa 24814980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 29991918 - 29992027
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||||||||||||||||||| || ||||| ||||||||| ||||         || ||||||||||||| | |||||||  |||||||||    
29991918 taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtctctgtaaaaaaaaattattgtttttggtccttacaaaata--ttgtttttg 29992015  T
207 gaaatagtccct 218  Q
     |||||||||||    
29992016 aaaatagtccct 29992027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 32418318 - 32418431
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||| |||          |  ||||||||||||||||||||| ||||||||    
32418318 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaat--tgtttttggtccctgcaaaattttttgttt 32418415  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
32418416 tttaaaatagtccctg 32418431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 33526051 - 33526167
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| |||||||||||  | | |||||||||||||| |||         |  |||||||||||||||||||||| |||||||    
33526051 tggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtccatgtgaatttttttgtttgtttttggtccctgcaaaattttttgtt 33526150  T
203 tttggaaatagtccctg 219  Q
    |||  ||||||||||||    
33526151 ttttaaaatagtccctg 33526167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 42430120 - 42430032
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||||||  ||||||||||||||| |||         ||||||||||| |||||||||||    
42430120 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaatttttttttgttgttttttgtccctgcaaa 42430032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 4474044 - 4473988
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||| || ||||||||||| || ||||||||||||||||||||    
4474044 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt 4473988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 192
Target Start/End: Complemental strand, 5357762 - 5357675
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||||||||| |||||||||||  | |||||||||||||||  |||         |||||||||||||||||||||||    
5357762 gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtctttgtaatttttttttgttgtttttggtccctgcaaa 5357675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 218
Target Start/End: Complemental strand, 6146781 - 6146733
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||| |||||||||||||||||||| ||||||||||| |||||||||||    
6146781 ttgtagtttttggtccctgcaaaattttttgtttttgaaaatagtccct 6146733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 15719979 - 15719931
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    ||||||||||| ||||| || ||||||||||||||||||||||||||||    
15719979 ggctaaaatataattttagtttctgcaaatatgtcttgttttggtttta 15719931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 16789075 - 16789131
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||    
16789075 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 16789131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 20277692 - 20277748
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||| ||||||||||||||    
20277692 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt 20277748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 21064319 - 21064375
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||| ||||||||||||||    
21064319 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt 21064375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 219
Target Start/End: Original strand, 21509765 - 21509809
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||| ||||||||||| ||||||||||||    
21509765 gtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 21509809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 25131111 - 25131167
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||    
25131111 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 25131167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 28497255 - 28497307
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||||||||||| ||||||||||| || ||||| ||||||||||    
28497255 ggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc 28497307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 32040075 - 32040131
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| || ||| |||||||||||| | ||||||||||||||||||||    
32040075 ggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgt 32040131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 42429758 - 42429869
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| || |||||||| ||  ||| |||||||||||||||         ||||||||||||||||||||||||||  ||||||    
42429758 ggctaaaatatggttttggtccctacaaatatgcctcattt-ggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaata--ttgttt 42429854  T
204 ttggaaatagtccct 218  Q
    ||| ||||| |||||    
42429855 ttgaaaataatccct 42429869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 43477163 - 43477219
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
43477163 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 43477219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 1526172 - 1526117
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
1526172 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg 1526117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 216
Target Start/End: Original strand, 2811652 - 2811687
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||||||||||||||||||||    
2811652 ggtccctgcaaaatattttgtttttggaaatagtcc 2811687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 3680801 - 3680746
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||||||| || ||||||||||| || ||||||||||| |||||||    
3680801 ggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg 3680746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 219
Target Start/End: Original strand, 6146684 - 6146731
Alignment:
172 gttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||||||| ||||||||||| ||||||| ||||    
6146684 gttgtttttggtccctgcaaaattttttgtttttgaaaatagttcctg 6146731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 8298798 - 8298837
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||| |||||||||||||    
8298798 ggtccctgcaaaatattttgtttttgaaaatagtccctgc 8298837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 10873069 - 10873030
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||| |||||||||||||    
10873069 ggtccctgcaaaatattttgtttttgaaaatagtccctgc 10873030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 13232409 - 13232448
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||| |||||||||||||    
13232409 ggtccctgcaaaatattttgtttttgaaaatagtccctgc 13232448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 15719654 - 15719709
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||||||||| |||| ||| |||||||||| ||| |||||||||||||||||    
15719654 ttggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc 15719709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 19494413 - 19494358
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
19494413 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 19494358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 20984356 - 20984395
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||| |||||||||||||||||||    
20984356 ggtccctgcaaaatattttgattttggaaatagtccctgc 20984395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 22917564 - 22917619
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
22917564 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 22917619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 1163206 - 1163160
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||| |||||| ||||||||||| ||||||||||||    
1163206 ttgtttttggtccctacaaaattttttgtttttgaaaatagtccctg 1163160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 6146583 - 6146629
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||| ||||    
6146583 ttgtttttggtccctgcaaaattttttgtttttgaaaatagttcctg 6146629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 9175368 - 9175283
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| ||| ||||||| || ||||||||||||||| ||||         |||||||||||||||||||||||    
9175368 taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgtaaattttttttgttgtttttggtccctgcaaa 9175283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 215
Target Start/End: Complemental strand, 9496513 - 9496479
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||||||||||||||||    
9496513 ggtccctgcaaaatattttgtttttggaaatagtc 9496479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 11019730 - 11019768
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||| |||||||||||||||||||||||||||||||||    
11019730 ggtccttgcaaaatattttgtttttggaaatagtccctg 11019768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 22917859 - 22917813
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||||||    
22917859 ttgtttttggtccatgcaaaattttttgtttttgaaaatagtccctg 22917813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 24955010 - 24954956
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||    
24955010 ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct 24954956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #152
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 182 - 220
Target Start/End: Original strand, 25600443 - 25600481
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||| |||||||||||||    
25600443 gtccctgcaaaatattttgtttttgaaaatagtccctgc 25600481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #153
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 29158522 - 29158568
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||| |||||||||||||||||||| ||||||||||| |||||||||    
29158522 ttgtagtttttggtccctgcaaaattttttgtttttgaaaatagtcc 29158568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #154
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 30336990 - 30337036
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||||||    
30336990 ttgtttttggtccttgcaaaattttttgtttttgaaaatagtccctg 30337036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #155
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 32040305 - 32040263
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||| ||||||||    
32040305 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtc 32040263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #156
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 219
Target Start/End: Original strand, 4016972 - 4017017
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||||| ||||||||||  ||||||||||||    
4016972 tgtttttggtccctgcaaaattttttgttttttaaaatagtccctg 4017017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #157
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 13154886 - 13154974
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||  ||||| ||  |||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||    
13154886 ggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaattttcttttgttgtttttggtccctgcaaa 13154974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #158
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 19962995 - 19963111
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgc-aaaatattttgtt 202  Q
    |||||||||||| | || |||  ||||||||||||| ||||| ||||||||||||||         || ||||||||| ||||||| ||||| |||||||    
19962995 ggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgtaaaataaaatttttgtttttgatccctgcaaaaattttttgtt 19963094  T
203 tttggaaatagtccctg 219  Q
    |||  ||||||||||||    
19963095 ttttaaaatagtccctg 19963111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #159
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 23939843 - 23939802
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    ||||||||||||||||||||| |||||||||||| |||||||    
23939843 ttgtttttggtccctgcaaaacattttgtttttgaaaatagt 23939802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #160
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 40844532 - 40844479
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||| ||| |||||||||| ||| ||||||||||||||||||||    
40844532 taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgt 40844479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 2728387 - 2728347
Alignment:
181 ggtccctgcaaaatattttgt-ttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||| |||||||||||||||||||    
2728387 ggtccctgcaaaatattttgttttttggaaatagtccctgc 2728347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||| ||||| || |||||||||||||| |||||||||||||||    
2811778 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 2811730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 5725940 - 5725856
Alignment:
19 tatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    ||||||||||||||||||||| |||||||||||| ||  || || | ||||| || |||||| |||| ||||| ||| |||||||    
5725940 tatatgatagataaattatagacatttgcataacttacttgattatcaaaaatgcctcaatttctctaggtcacgaaatcaaatt 5725856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 7420441 - 7420473
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatag 213  Q
    |||||||||||||||||||||||||||||||||    
7420441 ggtccctgcaaaatattttgtttttggaaatag 7420473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 158
Target Start/End: Complemental strand, 25131449 - 25131393
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||||| |||| ||  ||||||||||| || ||||||||||||||||||    
25131449 ttggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct 25131393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 28258241 - 28258189
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| ||||   |||||||||||||||| ||||||||||||||||    
28258241 ggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc 28258189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #167
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 28430133 - 28430049
Alignment:
19 tatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    |||||||||||||||||  || ||||| |||||| |||||||||   || || || ||||||||||||||| ||||||| |||||    
28430133 tatatgatagataaatttaagacatttacataacttaactggttaccaagaaggcctcaattactcttggtaatgaatttaaatt 28430049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #168
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 29488110 - 29488054
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||    
29488110 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt 29488054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #169
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 35346839 - 35346871
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatag 213  Q
    |||||||||||||||||||||||||||||||||    
35346839 ggtccctgcaaaatattttgtttttggaaatag 35346871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 1686492 - 1686527
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
1686492 ttgtagtttttggtccctgcaaaatattttgttttt 1686527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #171
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 4017300 - 4017245
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| |||  |||||||||| || |||||||||||||||||||    
4017300 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 4017245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #172
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 7272588 - 7272623
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
7272588 ttgtagtttttggtccctgcaaaatattttgttttt 7272623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 10755364 - 10755329
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
10755364 ttgtagtttttggtccctgcaaaatattttgttttt 10755329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 13779531 - 13779476
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||  ||||||| ||||||||||| || ||||||||||||| ||||||    
13779531 gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgt 13779476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 14488882 - 14488917
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
14488882 ttgtagtttttggtccctgcaaaatattttgttttt 14488917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 107 - 158
Target Start/End: Original strand, 14847828 - 14847879
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    ||||||||||||||| || ||||||||||| ||  |||||||||||||||||    
14847828 taaaatatgattttgatccctgcaaatatgcctcattttggttttagtccct 14847879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 15719823 - 15719858
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
15719823 ttgtagtttttggtccctgcaaaatattttgttttt 15719858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 18549371 - 18549406
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
18549371 ttgtagtttttggtccctgcaaaatattttgttttt 18549406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 24187734 - 24187769
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
24187734 ttgtagtttttggtccctgcaaaatattttgttttt 24187769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 24954844 - 24954809
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
24954844 ttgtagtttttggtccctgcaaaatattttgttttt 24954809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 27341423 - 27341388
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
27341423 ttgtagtttttggtccctgcaaaatattttgttttt 27341388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 28398872 - 28398837
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
28398872 ttgtagtttttggtccctgcaaaatattttgttttt 28398837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 29487944 - 29487909
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
29487944 ttgtagtttttggtccctgcaaaatattttgttttt 29487909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 30337089 - 30337124
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
30337089 ttgtagtttttggtccctgcaaaatattttgttttt 30337124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 30969399 - 30969454
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| ||||||||  | ||||||||| | ||||||||||||||||||||    
30969399 gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgt 30969454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 32418512 - 32418477
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
32418512 ttgtagtttttggtccctgcaaaatattttgttttt 32418477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 33636490 - 33636525
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
33636490 ttgtagtttttggtccctgcaaaatattttgttttt 33636525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #188
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    ||||||||||| |||||||| |||||||| ||||| ||||||||||||    
36044791 gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta 36044744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 1408072 - 1408115
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||  |||||||||||| |||||||||||    
1408072 ttgtttttggtccctgcaaa--attttgtttttgaaaatagtccct 1408115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 1408286 - 1408244
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| |||| |||||| ||||||||    
1408286 ttgtttttggtccctgcaaaattttttatttttgaaaatagtc 1408244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 204
Target Start/End: Original strand, 3068953 - 3068987
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    |||| ||||||||||||||||||||||||||||||    
3068953 ttgtagtttttggtccctgcaaaatattttgtttt 3068987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 159
Target Start/End: Original strand, 4016906 - 4016960
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||| |||| ||| ||||||||||| || |||||||||||| ||||||    
4016906 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg 4016960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 192
Target Start/End: Original strand, 4709929 - 4709994
Alignment:
127 tgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
4709929 tgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 4709994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 7578463 - 7578421
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||  ||||||||    
7578463 ttgtttttggtccctgcaaaattttttgttttttaaaatagtc 7578421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 8094652 - 8094682
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
8094652 gtttttggtccctgcaaaatattttgttttt 8094682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #196
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 216
Target Start/End: Original strand, 8298830 - 8298864
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||||||||| |||||||||    
8298830 gtccctgcaaaatattttgtttttgaaaatagtcc 8298864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 14488783 - 14488829
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||| | ||||||||||| ||||||||||||    
14488783 ttgtttttggtccttgcaaatttttttgtttttgaaaatagtccctg 14488829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 14496881 - 14496927
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||| ||||||||||| |||| |||||||    
14496881 ttgtttttggtccttgcaaaattttttgtttttgaaaatcgtccctg 14496927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #199
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 22917634 - 22917680
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||| ||||||||||| |||||| ||||||||||| ||||||||||||    
22917634 ttgattttggtccctacaaaattttttgtttttgaaaatagtccctg 22917680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #200
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 22917755 - 22917725
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
22917755 gtttttggtccctgcaaaatattttgttttt 22917725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #201
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| |||||||||| ||| |||||||||||||||||||    
23939620 ttttggtccctgcaaatatatctcgttttggttttagtccctg 23939662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #202
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 25131318 - 25131356
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
25131318 ggtccctgcaaaattttttgtttttgaaaatagtccctg 25131356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #203
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 211
Target Start/End: Complemental strand, 25702659 - 25702629
Alignment:
181 ggtccctgcaaaatattttgtttttggaaat 211  Q
    |||||||||||||||||||||||||||||||    
25702659 ggtccctgcaaaatattttgtttttggaaat 25702629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #204
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 27117976 - 27117922
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||||||| ||||||||||| ||  |||||||||| ||||||    
27117976 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct 27117922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #205
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 29158671 - 29158617
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||||| ||||  || |||||||||| ||| ||||||||||||||||    
29158671 ttggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc 29158617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #206
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 30337131 - 30337169
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
30337131 ggtccctgcaaaattttttgtttttgaaaatagtccctg 30337169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #207
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 219
Target Start/End: Complemental strand, 32195563 - 32195529
Alignment:
185 cctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||||    
32195563 cctgcaaaatattttgtttttgaaaatagtccctg 32195529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #208
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 40844327 - 40844289
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
40844327 ggtccctgcaaaattttttgtttttgaaaatagtccctg 40844289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #209
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 43477441 - 43477399
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||| ||||||||||  ||||||||||||    
43477441 ttttggtccctgcaaaattttttgttttttaaaatagtccctg 43477399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #210
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 204
Target Start/End: Complemental strand, 43727263 - 43727229
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    |||| ||||||||||||||||||||||||||||||    
43727263 ttgtagtttttggtccctgcaaaatattttgtttt 43727229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #211
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 156
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
43727431 ctaaaatatggttttagtc-ctgcaaatatgtctcgttttggttttagtcc 43727382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #212
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 44849543 - 44849585
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaata 212  Q
    |||| ||||||| ||||||||| ||||||||||||||||||||    
44849543 ttgtagtttttgatccctgcaacatattttgtttttggaaata 44849585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #213
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 220
Target Start/End: Complemental strand, 1408182 - 1408137
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||| |||||||||||||||||||  ||| |||||||||    
1408182 gtttttggtccttgcaaaatattttgtttttaaaaaaagtccctgc 1408137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #214
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 1526104 - 1526059
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||| ||| | ||||||||||| |||||||||||    
1526104 ttgtttttggtccctgtaaatttttttgtttttgaaaatagtccct 1526059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #215
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 156
Target Start/End: Original strand, 1685117 - 1685166
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||| |||| ||| ||||||||||| || ||||||||||||||||    
1685117 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 1685166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #216
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 2356245 - 2356192
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||| |   ||||||||||||| ||||||||||||||| ||||    
2356245 taaaatatgattttgattcatgcaaatatgtctcgttttggttttagtctctgt 2356192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #217
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 4375899 - 4375936
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
4375899 ggtccctgcaaaattttttgtttttgaaaatagtccct 4375936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #218
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 8094841 - 8094788
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||||||| |||| |||  |||||||||| || |||||||||||||||||    
8094841 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc 8094788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #219
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 156
Target Start/End: Original strand, 23360378 - 23360423
Alignment:
111 atatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||| ||||||||||||||||||||||| |||||  |||||||||    
23360378 atatggttttggtctctgcaaatatgtctcgttttaattttagtcc 23360423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #220
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 23360582 - 23360615
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagt 214  Q
    ||||||||||||||| ||||||||||||||||||    
23360582 ggtccctgcaaaatactttgtttttggaaatagt 23360615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #221
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 38930511 - 38930548
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
38930511 ggtccctgcaaaattttttgtttttgaaaatagtccct 38930548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #222
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 1162908 - 1162964
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||| |||| ||| |||||||||||  | |||||| ||||||||||||    
1162908 tggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg 1162964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #223
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 14488924 - 14488960
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||| ||||||||||| ||||||||||    
14488924 ggtccctgcaaaattttttgtttttgaaaatagtccc 14488960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #224
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 17574105 - 17574153
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||| |||||||| |||||||||||||  |||||| ||||||||    
17574105 taaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc 17574153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #225
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 18549201 - 18549257
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||  | ||||||||||||||| ||||    
18549201 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgt 18549257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #226
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 21125719 - 21125775
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||  |||| ||| ||||||||||| || |||||||||||| |||||||    
21125719 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgt 21125775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #227
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 24187569 - 24187625
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||  || |||||||||||  | ||||||||||||||||||||    
24187569 ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgt 24187625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #228
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 29992300 - 29992244
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| ||||||| ||||| || ||||||||||| || |||||| |||||||||||||    
29992300 ggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgt 29992244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #229
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 35115382 - 35115430
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||||||||| |  || ||||||||| |||||||||||||||||    
35115382 taaaatatgattttgcttcctacaaatatgttttgttttggttttagtc 35115430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #230
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 35345617 - 35345561
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||  ||||||||||| || |||||||||||| |||||||    
35345617 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgt 35345561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #231
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 136
Target Start/End: Original strand, 39439924 - 39439956
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatg 136  Q
    ||||||||||||||||||||| |||||||||||    
39439924 ggctaaaatatgattttggtccctgcaaatatg 39439956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #232
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 40066497 - 40066553
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||| |||||||| |||||    
40066497 ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgt 40066553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 238)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 1381247 - 1381363
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
1381247 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 1381346  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
1381347 ttggaaatagtccctgc 1381363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 101 - 217
Target Start/End: Complemental strand, 35928461 - 35928345
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||||||||||||||    
35928461 attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 35928362  T
201 tttttggaaatagtccc 217  Q
    |||||||||||||||||    
35928361 tttttggaaatagtccc 35928345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 5917126 - 5917242
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
5917126 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgttt 5917225  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
5917226 ttggaaatagtccctgc 5917242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 19565467 - 19565583
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
19565467 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttgttt 19565566  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
19565567 ttggaaatagtccctgc 19565583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 18258527 - 18258411
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||| |||         ||||||||||||||||| ||||||||||||||||    
18258527 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgttt 18258428  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
18258427 ttggaaatagtccctgc 18258411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 35877052 - 35876936
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||| ||||||         ||||||||||||||||||||||||||||||||||    
35877052 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 35876953  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||| ||||    
35876952 ttggaaatagtctctgc 35876936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 102 - 218
Target Start/End: Complemental strand, 40038860 - 40038744
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||         ||||||||||||||||||||||||||||||||    
40038860 ttggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgt 40038761  T
202 ttttggaaatagtccct 218  Q
    ||||| ||||| |||||    
40038760 ttttgaaaataatccct 40038744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 37271359 - 37271476
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatt-ttgtt 202  Q
    |||||||||||| |||||||||||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| || ||    
37271359 ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattttt 37271458  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
37271459 tttggaaatagtccctgc 37271476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 19685380 - 19685264
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | |||    
19685380 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattttt 19685281  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
19685280 ttggaaatagtccctgc 19685264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 20986089 - 20985973
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||| ||||||||||||          ||||||||||||||||||||||||||||||||||    
20986089 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 20985990  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
20985989 ttggaaatagtccctgc 20985973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 24443744 - 24443628
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | |||    
24443744 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattttt 24443645  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
24443644 ttggaaatagtccctgc 24443628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 106 - 217
Target Start/End: Complemental strand, 6912855 - 6912744
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||| ||||||||||||| |||||    
6912855 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccatgcaaaatattttattttt 6912756  T
206 ggaaatagtccc 217  Q
    ||||||||||||    
6912755 ggaaatagtccc 6912744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 30888160 - 30888275
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         || |||||||||||||||||||||| ||||||||    
30888160 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaattttttttttgtttttggtccctgcaaaattttttgttt 30888259  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
30888260 ttgaaaatagtccctg 30888275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 36973710 - 36973596
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||| |||||||||| |||||| |||||||||||||         ||||||||||||||||||||||||||||||||||    
36973710 ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 36973611  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
36973610 ttgaaaatagtccct 36973596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 40764780 - 40764666
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
40764780 ggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 40764681  T
204 ttggaaatagtccct 218  Q
    |||||||||||||||    
40764680 ttggaaatagtccct 40764666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 103 - 220
Target Start/End: Original strand, 45137 - 45254
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||| ||| ||||||||||||||||    
45137 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttgatccttgcaaaatattttgtt 45236  T
203 tttggaaatagtccctgc 220  Q
    ||| ||||| ||||||||    
45237 tttagaaatcgtccctgc 45254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 105 - 218
Target Start/End: Complemental strand, 2636992 - 2636880
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||||||| ||||||||||| || |||||||||||||||| |||         |||||||||||||||| ||||||||||||||||||    
2636992 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc-tgtaaaaaaaatttgttgtttttggtccttgcaaaatattttgtttt 2636894  T
205 tggaaatagtccct 218  Q
    ||||||||||||||    
2636893 tggaaatagtccct 2636880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 106 - 219
Target Start/End: Complemental strand, 20691094 - 20690981
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||||||||||||  ||||||||||| || |||||||||||||||  |||         ||||| ||||||||||||||||||||||||||||||    
20691094 ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtctttgtaattcttttttgttctttttggtccctgcaaaatattttgttttt 20690995  T
206 ggaaatagtccctg 219  Q
    | ||||||||||||    
20690994 gaaaatagtccctg 20690981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 41732381 - 41732282
Alignment:
1 tggttataagtatattactatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaa 100  Q
    |||||||||||||||||   |||||||||||||||| || ||||||||||| ||||||| ||  |||||| || | ||||||||||||||||||||||||    
41732381 tggttataagtatatta---tatgatagataaattacagacatttgcataatataactgattactaaaaatgcctaaattactcttggtcatgaattcaa 41732285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 5904008 - 5904122
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| ||  |||||||||| || |||||| |||||||||||||         |||||||||||| |||||||||||||||||||||    
5904008 ggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgtaaattatttttgttgtttttgatccctgcaaaatattttgttt 5904107  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
5904108 ttgaaaatagtccct 5904122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 30800850 - 30800737
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||         || |||||||||||||||||||||| ||||||||    
30800850 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaattttt--tttttgtttttggtccctgcaaaattttttgttt 30800753  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
30800752 ttgaaaatagtccctg 30800737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 102 - 218
Target Start/End: Complemental strand, 20661313 - 20661199
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| ||||||||  ||||||||||  | ||||||||||||||||||||         ||||||||||||||||||||||||||  ||||    
20661313 ttggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaata--ttgt 20661216  T
202 ttttggaaatagtccct 218  Q
    ||||| |||||||||||    
20661215 ttttgaaaatagtccct 20661199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 107 - 204
Target Start/End: Complemental strand, 26071613 - 26071517
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||||||| || |||||||||||||| ||||||||||||||||||||         || ||||||||||||||||||||||||||||||||    
26071613 taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgtaatttttgttt-ttgtttttggtccctgcaaaatattttgtttt 26071517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 101 - 218
Target Start/End: Complemental strand, 42596820 - 42596704
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||| ||||||||| |||||||| ||||||||||| || ||||| ||||||||||||||         |||||| |||||||||||| |||||||||||    
42596820 attggttaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaaaaattttttgttg-ttttggtccctgtaaaatattttg 42596722  T
201 tttttggaaatagtccct 218  Q
    |||||| |||||||||||    
42596721 tttttgaaaatagtccct 42596704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 102 - 218
Target Start/End: Complemental strand, 42554010 - 42553894
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||| | |||| |||||||| | |||||||| | ||||||||||||||||| || |         ||||||||||||||||||||||||||||||||    
42554010 ttggctacagtatggttttggtccccgcaaatatattttgttttggttttagtctctctaaattttttttgttgtttttggtccctgcaaaatattttgt 42553911  T
202 ttttggaaatagtccct 218  Q
    ||||| |||||||||||    
42553910 ttttgaaaatagtccct 42553894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 5614530 - 5614415
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||| |||||          | |||||||||||||||||||||| ||||||||    
5614530 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgttt 5614431  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
5614430 ttgaaaatagtccctg 5614415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 205
Target Start/End: Original strand, 29692744 - 29692845
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | |||||||||||||||||||||||||||||||    
29692744 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaagttttgtttttggtccctgcaaaatattttgttt 29692843  T
204 tt 205  Q
    ||    
29692844 tt 29692845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 36577722 - 36577834
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||            |||||||||| ||||||||||| ||||||||    
36577722 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggcccctgcaaaattttttgttt 36577818  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
36577819 ttgaaaatagtccctg 36577834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 196
Target Start/End: Complemental strand, 5917460 - 5917368
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatat 196  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||||||    
5917460 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatat 5917368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 28108159 - 28108048
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||||||| || |||||||| || ||||||||||||||||||||         || ||||||||||||||| ||||||||||| ||||||    
28108159 taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgtaattttg--tttttgtttttggtcccttcaaaatattttctttttg 28108062  T
207 gaaatagtccctgc 220  Q
     |||||||||||||    
28108061 aaaatagtccctgc 28108048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 100 - 192
Target Start/End: Original strand, 36973349 - 36973441
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||||| ||||||||||| ||||||||||| |||||||||||||| | |||         |||||||||||||||||||||||    
36973349 aattggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagttcatgtaaaaaatatttgttgtttttggtccctgcaaa 36973441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 42553641 - 42553698
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||    
42553641 tggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgt 42553698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 2217494 - 2217609
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
2217494 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 2217593  T
204 ttggaaatagtccctg 219  Q
    ||| || |||||||||    
2217594 ttgaaagtagtccctg 2217609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 170 - 218
Target Start/End: Original strand, 4736286 - 4736334
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||    
4736286 ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtccct 4736334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 106 - 158
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    ||||||||||||||| |||||||||||||||||| ||||||||||||||||||    
27850372 ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct 27850320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 29172886 - 29172772
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||           | |||||||||||||||||||||| ||||||||    
29172886 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaagaat-ttgtttttggtccctgcaaaattttttgttt 29172788  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
29172787 ttgaaaatagtccctg 29172772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 194
Target Start/End: Original strand, 1104858 - 1104948
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||| |||||||| ||||||||||| || |||||| |||||||||||||         |||||||||||||||||||||||||    
1104858 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaat 1104948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 1286682 - 1286796
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| | |||||| || |||||||| || ||||||||||||||||||||         |||||||||||| || ||||||||||||||||||    
1286682 ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttgatctctgcaaaatattttgttt 1286781  T
204 ttggaaatagtccct 218  Q
    ||  | |||||||||    
1286782 tttaagatagtccct 1286796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 5614166 - 5614280
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| ||||||||| |||          | |||||||||||||||| ||||| ||||||||    
5614166 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaaaaagaaaattttgtttttggtccctgtaaaattttttgttt 5614265  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
5614266 ttgaaaatagtccct 5614280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 19685017 - 19685072
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
19685017 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19685072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 105 - 219
Target Start/End: Original strand, 27916462 - 27916576
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||||| || ||  |||||||||||| | ||||||||||||||||||||          | |||||||||||||||||||||| |||||||||    
27916462 gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctgtaagaaaaaagttttgtttttggtccctgcaaaattttttgtttt 27916561  T
205 tggaaatagtccctg 219  Q
    |  ||||||||||||    
27916562 ttaaaatagtccctg 27916576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 219
Target Start/End: Complemental strand, 28863840 - 28863720
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnt---tgttgtttttggtccctgcaaaatattt 198  Q
    |||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||         |   | |||||||||||||||||||||| |||    
28863840 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatatatattgtttttggtccctgcaaaattttt 28863741  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||  ||||||||||||    
28863740 tgttttttaaaatagtccctg 28863720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 100 - 219
Target Start/End: Complemental strand, 29366953 - 29366835
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatttt 199  Q
    |||||||||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||         || | |||||||||||||||||||| ||||    
29366953 aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt-aattttttttatagtttttggtccctgcaaaatttttt 29366855  T
200 gtttttggaaatagtccctg 219  Q
    ||||||  ||||| ||||||    
29366854 gttttttaaaataatccctg 29366835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 215
Target Start/End: Complemental strand, 16038738 - 16038629
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||||||||| ||| ||||||||||| || ||||||||||||||| ||||            |||||||||||||||||||||| ||||||||||    
16038738 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 16038639  T
206 ggaaatagtc 215  Q
    | ||||||||    
16038638 gaaaatagtc 16038629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 219
Target Start/End: Complemental strand, 18633963 - 18633846
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| ||||||||||| || |||||||||||| ||||||             |||||||||||||||||||||| ||||||    
18633963 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgt 18633864  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
18633863 ttttgaaaatagtccctg 18633846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 28550825 - 28550939
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            ||||||||||||| |||||||| ||||||    
28550825 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaaaaaaa--attgtttttggtccttgcaaaattttttgt 28550922  T
202 ttttggaaatagtccct 218  Q
    ||||| |||||||||||    
28550923 ttttgaaaatagtccct 28550939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 1105148 - 1105060
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
1105148 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 1105060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 1381611 - 1381523
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
1381611 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa 1381523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 4736542 - 4736454
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||| | ||||||||||||||||||||         ||||||||||||||| |||||||    
4736542 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtctctgcaaa 4736454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 15635379 - 15635490
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| |||  |||||||||||||||||||||||||||||||||          |  | |||||||||||||||||||| |||||||||||    
15635379 taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggtaaaaaaaataat-gtttttggtccctgcaaaattttttgtttttg 15635477  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
15635478 aaaatagtccctg 15635490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 19565831 - 19565743
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
19565831 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 19565743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 20690728 - 20690789
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| |||||||||||| |||||||| |||||||||||||| ||||||||||||||| ||||    
20690728 aaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt 20690789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 204
Target Start/End: Original strand, 24781989 - 24782089
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
24781989 ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgttaaaagaaaaatttgtttttggtccctgcaaaattttttgttt 24782088  T
204 t 204  Q
    |    
24782089 t 24782089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 28863510 - 28863622
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||           |||||||||| |||||||||||| | ||||||    
28863510 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa---gttgtttttgctccctgcaaaatttgttgttt 28863606  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
28863607 ttgaaaatagtccctg 28863622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 219
Target Start/End: Original strand, 34125472 - 34125521
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||| |||||||||||||||||||||||||||||||| ||||||||||||    
34125472 ttgtagtttttggtccctgcaaaatattttgtttttgaaaatagtccctg 34125521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 35928064 - 35928152
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
35928064 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 35928152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 37271706 - 37271618
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||| ||||||||||||          |||||||||||||||||||||||    
37271706 ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 37271618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 188
Target Start/End: Original strand, 38170514 - 38170598
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctg 188  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||    
38170514 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctg 38170598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 40764415 - 40764503
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
40764415 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaagtttttttgttgtttttggtccctgcaaa 40764503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 42207242 - 42207355
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  || |||||||||| ||||||||||||||||||||          |  ||||||||||||||||||||| ||||||||    
42207242 ggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaaaaaaaaaat--tgtttttggtccctgcaaaattttttgttt 42207339  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
42207340 ttgaaaatagtccctg 42207355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 6912496 - 6912552
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||    
6912496 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 6912552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 18633599 - 18633713
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
18633599 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 18633697  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
18633698 ttgaaaatagtccctg 18633713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 26133413 - 26133357
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
26133413 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 26133357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 33336030 - 33335970
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
33336030 aattggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt 33335970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 36578083 - 36577972
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||         |  ||||||||||| |||||||||| ||||||||    
36578083 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaat--ttgtttttggt-cctgcaaaattttttgttt 36577987  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
36577986 ttgaaaatagtccct 36577972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 1381401 - 1381362
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
1381401 ggtccctgcaaaatattttgtttttggaaatagtccctgc 1381362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 2636667 - 2636757
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| ||||||||| |||| ||||||||||||||| |||          |||||||||||||||||||||||    
2636667 ttggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtctctgcaaaaaaaatttgttgtttttggtccctgcaaa 2636757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 5950176 - 5950283
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||             ||||||||||||||||||||| ||||||||    
5950176 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa----tgtttttggtccctgcaaaattttttgttt 5950271  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
5950272 ttgaaaatagtc 5950283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 19565621 - 19565582
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
19565621 ggtccctgcaaaatattttgtttttggaaatagtccctgc 19565582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 19685226 - 19685265
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
19685226 ggtccctgcaaaatattttgtttttggaaatagtccctgc 19685265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 20985723 - 20985813
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||| ||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
20985723 ttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 20985813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 219
Target Start/End: Original strand, 29172524 - 29172638
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             ||||||||||||| |||||||| |||||||||    
29172524 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccttgcaaaattttttgtttt 29172623  T
205 tggaaatagtccctg 219  Q
    || ||||||||||||    
29172624 tgaaaatagtccctg 29172638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 29875400 - 29875513
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||||||||  || ||||||||||| || |||||||||||||||||||           | |||||||||||||||||||| | ||||||||    
29875400 ggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaat-ttgtttttggtccctgcaaatttttttgttt 29875498  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
29875499 ttgaaaatagtccct 29875513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 35876898 - 35876937
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
35876898 ggtccctgcaaaatattttgtttttggaaatagtccctgc 35876937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 35928274 - 35928313
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
35928274 ggtccctgcaaaatattttgtttttggaaatagtccctgc 35928313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 38496782 - 38496669
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||| | |||||||||||||||||||           | |||||||||||||||| ||||| ||||||||    
38496782 ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggtaaaaaaaaat-ttgtttttggtccctgtaaaattttttgttt 38496684  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
38496683 ttgaaaatagtccct 38496669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 38554751 - 38554862
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || |||||||||| ||  ||||||||||||||| ||||         |||||||||||||| | |||||||||||||||||    
38554751 ggctaaaatatggttttgatccctgcaaatatctc--gttttggttttagtctctgtaaattttt-ttgttgtttttggttcatgcaaaatattttgttt 38554847  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
38554848 ttgaaaatagtccct 38554862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 6118426 - 6118380
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
6118426 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 6118380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 7075572 - 7075682
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||| ||||| ||||||||    
7075572 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa--attgtttttggtccctgtaaaattttttgttt 7075669  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
7075670 ttgaaaatagtcc 7075682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 14318045 - 14318157
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  ||||||||||||| |||||||||||||||| |||         ||||   ||||||||| |||||||| ||||||||    
14318045 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaattgt---ttttggtccttgcaaaattttttgttt 14318141  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
14318142 ttgaaaatagtccctg 14318157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 103 - 218
Target Start/End: Complemental strand, 21050914 - 21050802
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| |||||||||||  | |||||| |||||||||||||         |||||   ||||||||||||||||| |||||||    
21050914 tggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgtaaaaaaaaattgtt---tttggtccctgcaaaattttttgtt 21050818  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
21050817 tttgaaaatagtccct 21050802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 219
Target Start/End: Original strand, 29151514 - 29151631
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||||||||| ||| ||||||||||| || |||||| ||||||||||||             ||||||||||| |||| ||||| ||||||    
29151514 ttggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggttcctgtaaaattttttgt 29151613  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
29151614 ttttgaaaatagtccctg 29151631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 29693090 - 29692978
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| |||||||||||  | |||||||||||||||| |||         |||||   |||||||||| |||||| ||||||||    
29693090 ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaattgtt---tttggtccctacaaaattttttgttt 29692994  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
29692993 ttgaaaatagtccctg 29692978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 30800494 - 30800604
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| ||||| ||    
30800494 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaattttttg-tt 30800588  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
30800589 ttgaaaatagtccctg 30800604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 39379541 - 39379495
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
39379541 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 39379495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 217
Target Start/End: Complemental strand, 40168008 - 40167896
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  |||| |||  ||||||||||||| ||||||||||||||||||||          | |||||||||||||||||||||| ||||||||    
40168008 ggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaat-ttgtttttggtccctgcaaaattttttgttt 40167910  T
204 ttggaaatagtccc 217  Q
    ||  ||||||||||    
40167909 tttaaaatagtccc 40167896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 100 - 156
Target Start/End: Complemental strand, 9588616 - 9588559
Alignment:
100 aattggctaaaatatgatttt-ggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||| |||||||||||||||| |||| |||||||||||||| ||||||||||||||||    
9588616 aattagctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtcc 9588559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 10744054 - 10743941
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  ||||||||||||| ||||||||||||||||||||         |  ||||||||||||||| |||| | ||||||||    
10744054 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaat--ttgtttttggtccctacaaatttttttgttt 10743957  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
10743956 tttaaaatagtccctg 10743941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 15635639 - 15635594
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||    
15635639 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccct 15635594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 23382302 - 23382245
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||| |||||||||||| |||| ||| ||||||||||| |||||||||||||||||||    
23382302 aaatcggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc 23382245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 24443380 - 24443468
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| ||  ||||||||||||||||||          |||||||||||||||||||||||    
24443380 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 24443468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 106 - 218
Target Start/End: Complemental strand, 35609635 - 35609523
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaata-ttttgtttt 204  Q
    |||||||||| |||||||| |||||||||||||| |||||||||||||| ||| |         |||||||||||| |||| |||||||| |||||||||    
35609635 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctct-aaaaaaaattgttgtttttgatccccgcaaaatatttttgtttt 35609537  T
205 tggaaatagtccct 218  Q
    || ||||| |||||    
35609536 tgaaaataatccct 35609523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 35876688 - 35876776
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
35876688 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 35876776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 38786159 - 38786268
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||          |  ||||||||||||||||||||| ||||||||    
38786159 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaat--tgtttttggtccctgcaaaattttttgttt 38786256  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
38786257 ttgaaaatagtc 38786268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 40029498 - 40029441
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
40029498 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 40029441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 218
Target Start/End: Complemental strand, 3850460 - 3850412
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||| |||||||||||||||||||| ||||||||||| |||||||||||    
3850460 ttgtagtttttggtccctgcaaaatcttttgtttttgaaaatagtccct 3850412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 4203770 - 4203714
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| |||||||||||||    
4203770 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 4203714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 10830529 - 10830585
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||||||||| |||||||| || |||||||||||||| |||||    
10830529 ggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgt 10830585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 102 - 158
Target Start/End: Original strand, 15916284 - 15916340
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||| ||| |||||||| ||||||||||||||  |||||||||||||||||    
15916284 ttggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct 15916340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 16038377 - 16038487
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||| |||            |||||||||||||||||||||| ||||||||    
16038377 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 16038475  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
16038476 ttgaaaatagtc 16038487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 18046038 - 18046094
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| |||||||||||||    
18046038 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 18046094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 20660948 - 20661000
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||    
20660948 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc 20661000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 21124913 - 21124969
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||  || |||||||||||||| ||||||||||||||||||||    
21124913 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt 21124969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 23381950 - 23382006
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||    
23381950 ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt 23382006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 219
Target Start/End: Complemental strand, 23382239 - 23382195
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||| ||||||||||| ||||||||||||    
23382239 gtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 23382195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 159
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| ||| ||||||||||| || |||||||||||||||||||    
39379242 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 39379294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 45292 - 45253
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||| ||||||||||||||||||||||||||||||||||    
45292 ggtccatgcaaaatattttgtttttggaaatagtccctgc 45253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 3850599 - 3850544
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||| ||||||| |||| ||| |||||||||||||| |||||||||||||||||||    
3850599 ggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 3850544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 11799129 - 11799184
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| |||||||||||  |||||||||||||||||||||    
11799129 ggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg 11799184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 18258162 - 18258217
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| ||||||||||| ||  ||||||||||||||||||    
18258162 ggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg 18258217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 18258373 - 18258412
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||| |||||||||||||||||||    
18258373 ggtccctgcaaaatattttgattttggaaatagtccctgc 18258412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 20985935 - 20985974
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||| ||||||||||||||    
20985935 ggtccctgcaaaatattttgttttttgaaatagtccctgc 20985974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 216
Target Start/End: Original strand, 21050642 - 21050685
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||||||||||||| ||||||||||| |||||||||    
21050642 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtcc 21050685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 22551318 - 22551263
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||| ||||||| |||||||| ||||||||||||||||| ||||    
22551318 gctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtctctgt 22551263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 216
Target Start/End: Original strand, 24443590 - 24443625
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||||||||||||||||||||    
24443590 ggtccctgcaaaatattttgtttttggaaatagtcc 24443625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 29875725 - 29875670
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
29875725 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 29875670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 194
Target Start/End: Complemental strand, 32109096 - 32109007
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||| ||||||||||||||  ||||||||||| | ||||||||||||||||||||         ||||||||||||||| |||||||||    
32109096 ggctaatatatgattttggtcg-tgcaaatatgtttcgttttggttttagtccctgtaaaaaattcttgttgtttttggtctctgcaaaat 32109007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 219
Target Start/End: Complemental strand, 35166088 - 35166045
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||| ||||||||||| ||||||||||||    
35166088 tttttggtccctgcaaaattttttgtttttgaaaatagtccctg 35166045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 35167165 - 35167110
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
35167165 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 35167110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 2217854 - 2217800
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||    
2217854 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 2217800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 7075893 - 7075847
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||||||    
7075893 ttgtttttggtccgtgcaaaattttttgtttttgaaaatagtccctg 7075847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 10409000 - 10409046
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||| |||||||||||| ||||||||||| ||||||||||||    
10409000 ttgtttttgatccctgcaaaattttttgtttttgaaaatagtccctg 10409046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 99 - 204
Target Start/End: Original strand, 12144902 - 12145006
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||| ||| ||||||| ||  |||||||||||||||||||         || |||||||||||||||||||||||| |    
12144902 aaataggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgtatttttttgtt-ttgtttttggtccctgcaaaatatgt 12145000  T
199 tgtttt 204  Q
    ||||||    
12145001 tgtttt 12145006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 21125106 - 21125060
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||| ||||||||||||||||||||||||||||||| |||| |||||    
21125106 ttgtagtttttggtccctgcaaaatattttgtttttagaaaaagtcc 21125060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 24782208 - 24782166
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||| ||||||||    
24782208 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtc 24782166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 103 - 212
Target Start/End: Original strand, 25561704 - 25561813
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| |||||||||||  | |||||||||||||||||||             |||||||||||||||||||||| |||||||    
25561704 tggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt 25561803  T
203 tttggaaata 212  Q
    |||| |||||    
25561804 tttgaaaata 25561813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 214
Target Start/End: Complemental strand, 28871994 - 28871886
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||| |||| |||||||| ||||||||||| || |||||||||||||| |||||         || ||||||||||| ||||||||||| |||||||    
28871994 ggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt-aaagaaatttattgtttttggt-cctgcaaaataatttgttt 28871897  T
204 ttggaaatagt 214  Q
    ||| |||||||    
28871896 ttgaaaatagt 28871886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 150
Target Start/End: Complemental strand, 38182087 - 38182041
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttt 150  Q
    |||||||||||| ||||||| ||||||||||||||| ||||||||||    
38182087 ggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38182041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 38189044 - 38189090
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttt 150  Q
    |||||||||||| ||||||| ||||||||||||||| ||||||||||    
38189044 ggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38189090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 150
Target Start/End: Complemental strand, 38209313 - 38209267
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttt 150  Q
    |||||||||||| ||||||| ||||||||||||||| ||||||||||    
38209313 ggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38209267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 38216269 - 38216315
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttt 150  Q
    |||||||||||| ||||||| ||||||||||||||| ||||||||||    
38216269 ggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38216315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 38496488 - 38496530
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||| ||||||||    
38496488 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtc 38496530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 174 - 216
Target Start/End: Complemental strand, 42207519 - 42207477
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||||| ||||||||||| |||||||||    
42207519 tgtttttggtccctgcaaaattttttgtttttgaaaatagtcc 42207477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 6118501 - 6118444
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| |||| ||| ||||||||||| || |||||||||||| ||||||    
6118501 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg 6118444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 9532465 - 9532420
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||| |||||||| ||||||||||| |||||||||||    
9532465 ttgtttttggtccttgcaaaattttttgtttttgaaaatagtccct 9532420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 10409257 - 10409212
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||| |||||||||||| ||||||||||| |||||||||||    
10409257 ttgtttttgatccctgcaaaattttttgtttttgaaaatagtccct 10409212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 10830897 - 10830844
Alignment:
104 ggctaaaatatgatttt-ggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||||||| |||| ||||||||||| ||| |||||||||||||||    
10830897 ggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtcc 10830844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 158
Target Start/End: Complemental strand, 11935967 - 11935914
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    ||||||||||||||||||||||||||||||||  || |||| |||||| |||||    
11935967 gctaaaatatgattttggtctctgcaaatatgctttattttcgttttaatccct 11935914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 219
Target Start/End: Original strand, 15635543 - 15635592
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||| ||||||||||| |||||||| ||||||||||| ||||||||||||    
15635543 ttgtagtttttggtccgtgcaaaattttttgtttttgaaaatagtccctg 15635592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 17070746 - 17070783
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||| |||||||||||||||||||||||||||||||||    
17070746 ggtctctgcaaaatattttgtttttggaaatagtccct 17070783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 26133182 - 26133239
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| |||| ||| || |||||||| || ||||||||||||||||||||    
26133182 tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 26133239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 28213373 - 28213461
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| ||  ||||||||||||||| |||         ||||| |||||||||||||||||    
28213373 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccatgtaatttttttttgttatttttggtccctgcaaa 28213461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #143
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 28871640 - 28871693
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||||| ||||||||||   | ||||||||||||||||||||    
28871640 taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgt 28871693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #144
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 192
Target Start/End: Original strand, 32888691 - 32888775
Alignment:
108 aaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||| |||||||| ||||||||||  || ||||| ||||||||||||||         |||||||||||||||||||||||    
32888691 aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaatttttttttgttgtttttggtccctgcaaa 32888775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #145
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 153
Target Start/End: Original strand, 35166911 - 35166960
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttag 153  Q
    |||||||||||| |||| ||| ||||||||||| ||||||||||||||||    
35166911 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag 35166960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #146
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 35609302 - 35609359
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| ||||||||  ||||||||||  | ||||||||||||||||||||    
35609302 tggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgt 35609359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #147
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 103
Target Start/End: Complemental strand, 37941359 - 37941263
Alignment:
4 ttataagtatattactatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    ||||||||||||||   |||||||||||||||  || |||||| ||||| |||||   | | |||||  | |||||||||||||||||||||||||||||    
37941359 ttataagtatatta---tatgatagataaattgcagacatttgtataacttaactcactataaaaaagacctcaattactcttggtcatgaattcaaatt 37941263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #148
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 40029141 - 40029252
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||| |||||||||| |||||||||||| |||||||            |||||||| ||||||| ||||| ||||||||    
40029141 ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgtaaaaaaaaa---ttgtttttcgtccctgtaaaattttttgttt 40029237  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
40029238 ttgaaaatagtccct 40029252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #149
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 95 - 160
Target Start/End: Original strand, 40167777 - 40167842
Alignment:
95 attcaaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||  ||||||| |||| |||| ||| ||||||||||| || ||||||||||||||||||||    
40167777 attcaaaaaggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 40167842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #150
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 40764625 - 40764662
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||| ||||||||||||||||||||||||||||||||    
40764625 ggtccttgcaaaatattttgtttttggaaatagtccct 40764662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||| |||| |||| ||| |||||||||||||| ||||||||||||||||    
2032940 ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc 2032888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #152
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 148
Target Start/End: Original strand, 4736205 - 4736249
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggt 148  Q
    |||||||||||| ||||||||| ||||||||||||| ||||||||    
4736205 ggctaaaatatggttttggtctttgcaaatatgtctcgttttggt 4736249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 10743724 - 10743776
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||    
10743724 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 10743776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 218
Target Start/End: Original strand, 10743793 - 10743837
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||| | ||||||||| |||||||||||    
10743793 tgtttttggtccctgcaaaatttgttgtttttgaaaatagtccct 10743837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #155
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 11799458 - 11799402
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||  |||||||||| || ||||||||||||||||||||    
11799458 ggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgt 11799402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #156
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 17070535 - 17070590
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||||| | |||| |||||||||||||    
17070535 ggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctgt 17070590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 18046348 - 18046296
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||    
18046348 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 18046296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 20683747 - 20683803
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||||||||||||||  | |||||| |||||||||||||    
20683747 ggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgt 20683803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 26071291 - 26071347
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||  ||| |||| ||||||||||||||  |||||||||||||||||||    
26071291 ggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgt 26071347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 31037741 - 31037693
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||    
31037741 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 31037693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 32108808 - 32108864
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||| | ||||| |||||| |||||||    
32108808 ggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgt 32108864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 220
Target Start/End: Complemental strand, 35928344 - 35928312
Alignment:
188 gcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||||||||||    
35928344 gcaaaatattttgtttttggaaatagtccctgc 35928312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 38962804 - 38962856
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||||| |||| ||| ||| |||||||||| ||||||||||||||    
38962804 ttggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt 38962856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 42596453 - 42596509
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||| || | |||||||| |||||||||||||||||| |||||    
42596453 ggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgt 42596509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #165
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 3850657 - 3850622
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
3850657 ttgtagtttttggtccctgcaaaatattttgttttt 3850622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #166
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 5104002 - 5103951
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    ||||||||||||| |||||||  ||||||||||||||  |||||||||||||    
5104002 tggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt 5103951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 6118327 - 6118292
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
6118327 ttgtagtttttggtccctgcaaaatattttgttttt 6118292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 216
Target Start/End: Original strand, 6912708 - 6912743
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||| ||||||||||||||||    
6912708 ggtccctgcaaaatattttatttttggaaatagtcc 6912743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 7075794 - 7075759
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
7075794 ttgtagtttttggtccctgcaaaatattttgttttt 7075759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 10408928 - 10408983
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||| ||||||||||||    
10408928 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 10408983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #171
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 15635707 - 15635652
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| | ||||||||| || |||||||||||||||||||    
15635707 ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg 15635652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #172
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 16038572 - 16038537
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
16038572 ttgtagtttttggtccctgcaaaatattttgttttt 16038537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 18633793 - 18633758
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
18633793 ttgtagtttttggtccctgcaaaatattttgttttt 18633758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 25561875 - 25561910
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
25561875 ttgtagtttttggtccctgcaaaatattttgttttt 25561910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 27850209 - 27850174
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
27850209 ttgtagtttttggtccctgcaaaatattttgttttt 27850174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 28550993 - 28551028
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
28550993 ttgtagtttttggtccctgcaaaatattttgttttt 28551028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 29151684 - 29151719
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
29151684 ttgtagtttttggtccctgcaaaatattttgttttt 29151719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 29692925 - 29692890
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
29692925 ttgtagtttttggtccctgcaaaatattttgttttt 29692890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 29855614 - 29855669
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||||||  || ||||||| ||  |||||||||||||||||||    
29855614 gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgt 29855669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 218
Target Start/End: Original strand, 29855820 - 29855855
Alignment:
183 tccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||||| |||||||||||    
29855820 tccctgcaaaatattttgtttttgaaaatagtccct 29855855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 31155538 - 31155503
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
31155538 ttgtagtttttggtccctgcaaaatattttgttttt 31155503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 33335857 - 33335822
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
33335857 ttgtagtttttggtccctgcaaaatattttgttttt 33335822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 33335956 - 33335913
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||| ||||||||| ||||||||||| |||||||||    
33335956 ttgtttttggtcgctgcaaaattttttgtttttgaaaatagtcc 33335913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 35166158 - 35166103
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||| |||||| |||| ||| ||||||| |||||| |||||||||||||||||||    
35166158 ggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg 35166103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 36577887 - 36577922
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
36577887 ttgtagtttttggtccctgcaaaatattttgttttt 36577922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 38786324 - 38786359
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
38786324 ttgtagtttttggtccctgcaaaatattttgttttt 38786359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 39761510 - 39761475
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
39761510 ttgtagtttttggtccctgcaaaatattttgttttt 39761475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 294020 - 293990
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
294020 gtttttggtccctgcaaaatattttgttttt 293990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 2217685 - 2217655
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
2217685 gtttttggtccctgcaaaatattttgttttt 2217655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 4203456 - 4203506
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||    
4203456 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 4203506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 5614320 - 5614282
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||||||| ||||||||||||    
5614320 ggtccctgcaaaaaattttgtttttgaaaatagtccctg 5614282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 9179750 - 9179720
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
9179750 gtttttggtccctgcaaaatattttgttttt 9179720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 151
Target Start/End: Complemental strand, 12145186 - 12145136
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    |||| |||||||||| |||||||| |||||||||||||| |||||| ||||    
12145186 attgactaaaatatggttttggtccctgcaaatatgtctcgttttgatttt 12145136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 14318333 - 14318287
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| | |||||| ||||||||||| ||||||||||||    
14318333 ttgtttttggtccttacaaaattttttgtttttgaaaatagtccctg 14318287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 157
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    ||||||||| |||  |||||||||||||||||| |||||| ||||||||||    
20418013 taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc 20417963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #196
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 25778989 - 25778959
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
25778989 gtttttggtccctgcaaaatattttgttttt 25778959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 25779093 - 25779047
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||| ||| |||||||| ||||||||||| ||||||||||||    
25779093 ttgtttttgatccttgcaaaattttttgtttttgaaaatagtccctg 25779047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Original strand, 28871711 - 28871753
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| ||||||||||||||  ||||||||||||||||||    
28871711 ttttggtccctgcaaatatgtctcattttggttttagtccctg 28871753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #199
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 29875572 - 29875602
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
29875572 gtttttggtccctgcaaaatattttgttttt 29875602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #200
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 30800679 - 30800649
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
30800679 gtttttggtccctgcaaaatattttgttttt 30800649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #201
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 31037464 - 31037506
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||| ||||||||||||| ||||||||||| ||||||||    
31037464 ttgttttttgtccctgcaaaattttttgtttttgaaaatagtc 31037506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #202
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 31037568 - 31037598
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
31037568 gtttttggtccctgcaaaatattttgttttt 31037598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #203
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 216
Target Start/End: Original strand, 31155440 - 31155482
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||| ||||| ||||||||||| |||||||||    
31155440 tgtttttggtccctgtaaaattttttgtttttgaaaatagtcc 31155482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #204
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 155
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||| |||||||||||||| |||||||||||||||    
31602221 ttttggtccctgcaaatatgtctcgttttggttttagtc 31602259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #205
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 37090455 - 37090501
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||| ||||||||||| ||||||| ||||    
37090455 ttgttttttgtccctgcaaaattttttgtttttgaaaatagttcctg 37090501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #206
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 152
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||| |||||||| |||||||||||||| |||||| |||||    
38452394 ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta 38452348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #207
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 38496592 - 38496622
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
38496592 gtttttggtccctgcaaaatattttgttttt 38496622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #208
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 219
Target Start/End: Original strand, 40167853 - 40167896
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||  |||||||||||| ||||||||||||    
40167853 tgtttttggtccctgcaaa--attttgtttttgaaaatagtccctg 40167896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #209
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 152
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    ||||||||| |||||||| |||||||||||| | ||||||||||||    
45501 taaaatatggttttggtccctgcaaatatgtttcgttttggtttta 45456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #210
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 1287042 - 1286989
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||||||| ||| ||||||||||  ||||||||||||| |||||    
1287042 taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgt 1286989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #211
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 6118285 - 6118248
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||| |||||||||||| |||||||||||    
6118285 ggtccctgcaaaaaattttgtttttgaaaatagtccct 6118248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #212
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 218
Target Start/End: Original strand, 9179665 - 9179706
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||| | ||||||||||| |||||||||||    
9179665 ttttggtccctgcaaatttttttgtttttgaaaatagtccct 9179706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #213
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 13990676 - 13990717
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||||||||||| ||||||||||  |||||||||    
13990676 gtttttggtccctgcaaaattttttgttttttaaaatagtcc 13990717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #214
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 152
Target Start/End: Original strand, 18286431 - 18286476
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    ||||||||| |||| ||  |||||||||||||||||||||||||||    
18286431 taaaatatggttttagttcctgcaaatatgtcttgttttggtttta 18286476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #215
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 20416360 - 20416413
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||||||| |||| ||| |||||||||||||| | |||||||| ||||||    
20416360 ggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc 20416413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #216
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 220
Target Start/End: Original strand, 28108016 - 28108049
Alignment:
187 tgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||| |||||||||||||    
28108016 tgcaaaatattttgtttttgaaaatagtccctgc 28108049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #217
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 66 - 103
Target Start/End: Original strand, 28440843 - 28440880
Alignment:
66 aaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    ||||| ||||||||||||||||||||| ||||||||||    
28440843 aaaaaggcttcaattactcttggtcataaattcaaatt 28440880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #218
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 29172733 - 29172770
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
29172733 ggtccctgcaaaattttttgtttttgaaaatagtccct 29172770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #219
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 31602441 - 31602404
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaata 212  Q
    |||||||||||||| ||||||||||||||||| |||||    
31602441 gtttttggtccctgtaaaatattttgtttttgaaaata 31602404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #220
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 36577934 - 36577971
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
36577934 ggtccctgcaaaattttttgtttttgaaaatagtccct 36577971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #221
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 39379437 - 39379474
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
39379437 ggtccctgcaaaattttttgtttttgaaaatagtccct 39379474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #222
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 293828 - 293880
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| ||||||||||| || |||||| |||||||||    
293828 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc 293880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #223
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 205
Target Start/End: Complemental strand, 3850756 - 3850724
Alignment:
173 ttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||| ||||||||||    
3850756 ttgtttttggtccctgcaaaattttttgttttt 3850724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #224
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 3851329 - 3851273
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||  |||||||||| |||||| |||||||||||||    
3851329 ggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgt 3851273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #225
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 9179593 - 9179649
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||  ||||||||||  | ||||||||||||||||||||    
9179593 ggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgt 9179649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #226
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 9179920 - 9179864
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||  |||||||||| || |||||||||||| |||||||    
9179920 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgt 9179864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #227
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Original strand, 9532259 - 9532299
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||| |||||||| ||||||||||| |||||||    
9532259 tgtttttggtccttgcaaaattttttgtttttgaaaatagt 9532299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #228
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 13990895 - 13990843
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||| | |||| ||| ||||||||||| || ||||||||||||||||    
13990895 ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 13990843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #229
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 17070863 - 17070807
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| || ||||||||||| ||||| ||||||| ||||||    
17070863 ggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctgt 17070807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #230
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 21050575 - 21050631
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||| ||| || ||||||||  | |||||| |||||||||||||    
21050575 ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgt 21050631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #231
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 25561999 - 25561951
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||    
25561999 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 25561951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #232
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 30888431 - 30888375
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||| || || | |||||| ||| ||||||||||||||| ||||    
30888431 ggctaaaatatgattttagtatccgtaaatatatctcgttttggttttagtctctgt 30888375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #233
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 219
Target Start/End: Original strand, 31037607 - 31037643
Alignment:
183 tccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||| ||||||||||| ||||||||||||    
31037607 tccctgcaaaattttttgtttttgaaaatagtccctg 31037643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #234
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 205
Target Start/End: Original strand, 31156079 - 31156107
Alignment:
177 ttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||    
31156079 ttttggtccctgcaaaatattttgttttt 31156107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #235
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Original strand, 32888760 - 32888800
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||| ||||||||||| |||||||||||||| |||||    
32888760 ttttggtccctgcaaatatgccttgttttggttttggtccc 32888800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #236
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 34125307 - 34125359
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||  |||| ||| ||||||||||| || ||||||||||||||||    
34125307 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 34125359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #237
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 34125632 - 34125576
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||| ||||||| ||  |||||||||||||||||||    
34125632 ggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt 34125576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #238
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 39379610 - 39379558
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||  | ||||||||||||||||    
39379610 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc 39379558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 293)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 35464018 - 35464134
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
35464018 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 35464117  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
35464118 ttggaaatagtccctgc 35464134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 13631228 - 13631342
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
13631228 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 13631327  T
204 ttggaaatagtccct 218  Q
    |||||||||||||||    
13631328 ttggaaatagtccct 13631342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 31560696 - 31560579
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| ||||||||||||||  |||||||||||||||||||         |||||||||||||||||||||||||||||||||    
31560696 tggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt 31560597  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
31560596 tttggaaatagtccctgc 31560579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 13530713 - 13530597
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
13530713 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 13530614  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
13530613 ttggaaatagtccctgc 13530597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 43231389 - 43231275
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
43231389 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 43231290  T
204 ttggaaatagtccct 218  Q
    |||||||||||||||    
43231289 ttggaaatagtccct 43231275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 29499182 - 29499298
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
29499182 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 29499281  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
29499282 ttggaaatagtccctgc 29499298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 30046792 - 30046676
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
30046792 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 30046693  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
30046692 ttggaaatagtccctgc 30046676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 30061133 - 30061017
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
30061133 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 30061034  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
30061033 ttggaaatagtccctgc 30061017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 99 - 218
Target Start/End: Complemental strand, 53916052 - 53915933
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||||||| |||||||||||||| |||||||||||||| ||||          |||||||||||||||||||||||||||||    
53916052 aaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattt 53915953  T
199 tgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||    
53915952 tgtttttggaaatagtccct 53915933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 102 - 219
Target Start/End: Original strand, 5797479 - 5797595
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||         |||||| ||||||||| |||||||||||||||    
5797479 ttggttaaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgtaaaaaaattttgttg-ttttggtccttgcaaaatattttgt 5797577  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
5797578 ttttgaaaatagtccctg 5797595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 106 - 218
Target Start/End: Complemental strand, 19903653 - 19903541
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||||||| |||||||||||||| |||||||||||||||| |||         ||||||||||||||||||||||||||||||||||||    
19903653 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaatattttgttttt 19903554  T
206 ggaaatagtccct 218  Q
    | |||||||||||    
19903553 gaaaatagtccct 19903541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 23245595 - 23245479
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || |||||||||||||| ||||||||||||||||||||         ||||||||||||||||| ||||||||||||||||    
23245595 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgttt 23245496  T
204 ttggaaatagtccctgc 220  Q
    |||||||| ||||||||    
23245495 ttggaaatggtccctgc 23245479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 42848027 - 42848143
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||  |||||||||||||| ||||||||||||||||||||         ||||||||||||||||| ||||||||||||||||    
42848027 ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgttt 42848126  T
204 ttggaaatagtccctgc 220  Q
    |||||||| ||||||||    
42848127 ttggaaatggtccctgc 42848143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 104 - 211
Target Start/End: Original strand, 25423924 - 25424031
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
25423924 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 25424023  T
204 ttggaaat 211  Q
    ||| ||||    
25424024 ttgaaaat 25424031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 101 - 216
Target Start/End: Original strand, 46115411 - 46115526
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||| ||||||||||||||    
46115411 attggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg 46115510  T
201 tttttggaaatagtcc 216  Q
    |||||| |||||||||    
46115511 tttttgaaaatagtcc 46115526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 101 - 216
Target Start/End: Original strand, 46128545 - 46128660
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||| ||||||||||||||    
46128545 attggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg 46128644  T
201 tttttggaaatagtcc 216  Q
    |||||| |||||||||    
46128645 tttttgaaaatagtcc 46128660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 14487802 - 14487916
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||| ||||||||         ||||||||||||||||||||||||||||||||||    
14487802 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 14487901  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
14487902 ttgaaaatagtccct 14487916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 24774045 - 24774161
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         || ||||||||||||| |||||||||||||||||    
24774045 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttattgtttttggtccttgcaaaatattttgttt 24774144  T
204 ttggaaatagtccctgc 220  Q
    ||| |||||||||||||    
24774145 ttgaaaatagtccctgc 24774161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 51762870 - 51762986
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| | ||||||||||||||||||  |  |||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
51762870 ggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 51762969  T
204 ttggaaatagtccctgc 220  Q
    ||| |||||||||||||    
51762970 ttgaaaatagtccctgc 51762986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 23779225 - 23779110
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||  || ||||||||||||||  |||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
23779225 ggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgtcaattttttttgttgtttttggtccctgcaaaatattttgttt 23779126  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
23779125 ttgaaaatagtccctg 23779110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 50753925 - 50754036
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||||||| |||||||||| |||||||||||||||||| |||||         |||||||||||||||||||||||||||||||| ||||    
50753925 taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgtaaatttcttttgttgtttttggtccctgcaaaatattttgtatttg 50754024  T
207 gaaatagtccct 218  Q
     |||||||||||    
50754025 aaaatagtccct 50754036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 26412190 - 26412307
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnntt-gttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| ||||| || |||||||||||||| |||||||||||||||||||          || |||||||||||||||||| ||||||||||||    
26412190 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaattttttttttgttgtttttggtccctgccaaatattttgtt 26412289  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
26412290 tttggaaatagtccctgc 26412307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 107 - 216
Target Start/End: Original strand, 47022743 - 47022852
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| ||||||||  ||||||||||||| |||||||||||||||||| |         |||||||||||||||||||||||||||||||||||||    
47022743 taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattttgtttttg 47022842  T
207 gaaatagtcc 216  Q
     |||||||||    
47022843 aaaatagtcc 47022852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 109 - 221
Target Start/End: Complemental strand, 47532667 - 47532555
Alignment:
109 aaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttgga 208  Q
    ||||||| ||||||||  ||||||||||||| |||||||||||||| |||||         ||||| |||||||||||||||||||||||| ||||||||    
47532667 aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaattgttatttttggtccctgcaaaatattttatttttgga 47532568  T
209 aatagtccctgct 221  Q
    |||||||||||||    
47532567 aatagtccctgct 47532555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 13074125 - 13074010
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||  || |||||||||||||||| |||         |||||||||||| |||||||||||||||||||||    
13074125 ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgtaatttttttttgttgtttttgatccctgcaaaatattttgttt 13074026  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
13074025 ttgaaaatagtccctg 13074010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 99 - 216
Target Start/End: Original strand, 20291981 - 20292098
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| ||||||||||||||||||||| ||||||||||| || ||||||||||||||| ||||         ||| |||||||||| | ||||||||||||    
20291981 aaataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgtaaattttttttggtgtttttggttcttgcaaaatattt 20292080  T
199 tgtttttggaaatagtcc 216  Q
    |||||||| |||||||||    
20292081 tgtttttgaaaatagtcc 20292098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 106 - 218
Target Start/End: Complemental strand, 35420701 - 35420588
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnntt-gttgtttttggtccctgcaaaatattttgtttt 204  Q
    |||||||||| ||||||||  ||||||||||||| | ||||||||||||||||||         || |||||||||||||||||||||||||||||||||    
35420701 ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaattttttttttgttgtttttggtccctgcaaaatattttgtttt 35420602  T
205 tggaaatagtccct 218  Q
    || |||||||||||    
35420601 tgaaaatagtccct 35420588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 106 - 218
Target Start/End: Original strand, 30564835 - 30564947
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||| ||| |||||||||||| ||||||||||||||||||||||         || ||||||||| |||||||||||||||||||||||    
30564835 ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgtagatttttgtttttgtttttgatccctgcaaaatattttgttttt 30564934  T
206 ggaaatagtccct 218  Q
    | ||||| |||||    
30564935 gaaaataatccct 30564947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 102 - 218
Target Start/End: Complemental strand, 35415635 - 35415519
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||          || |||||||||||||||||||||| ||||||    
35415635 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttgt 35415536  T
202 ttttggaaatagtccct 218  Q
    ||||| |||||||||||    
35415535 ttttgaaaatagtccct 35415519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 104 - 200
Target Start/End: Original strand, 42823776 - 42823872
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||         ||||||||||| |||||||||||||||||||    
42823776 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgtaaattttttttgttgtttttagtccctgcaaaatattttg 42823872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 105 - 220
Target Start/End: Complemental strand, 47136170 - 47136055
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||||||| ||||||||||||||  ||||||||||||||| |||         ||||||||||||||| || ||||||||||||||||    
47136170 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaaaaaatttttgttgtttttggtctctacaaaatattttgtttt 47136071  T
205 tggaaatagtccctgc 220  Q
    || |||||||| ||||    
47136070 tgaaaatagtctctgc 47136055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 104 - 211
Target Start/End: Original strand, 51738137 - 51738244
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| || ||||||||||| |||||||||||| |||||||         ||||| ||||||||||||||||||||||||||||    
51738137 ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgtaaaaaaaaattgttctttttggtccctgcaaaatattttgttt 51738236  T
204 ttggaaat 211  Q
    ||| ||||    
51738237 ttgaaaat 51738244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 99 - 218
Target Start/End: Complemental strand, 11693126 - 11693009
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||||||| |||||||||||||| |||||| |||||||||||||         ||| |||||||||||||||||||| ||||    
11693126 aaataggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgt-aaaaaaatttgatgtttttggtccctgcaaaa-attt 11693029  T
199 tgtttttggaaatagtccct 218  Q
    |||||||| |||||||||||    
11693028 tgtttttgaaaatagtccct 11693009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 13764807 - 13764693
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||| |||||||| | |||||||||||||||| |||         |||||||||||  |||||||||||||||||||||    
13764807 ggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtccatgtaaattatttttgttgtttttaatccctgcaaaatattttgttt 13764708  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
13764707 ttgaaaatagtccct 13764693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 35763955 - 35763841
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||| ||||| || |||||||||||||||||||          || |||||||||||||||||||||| ||||||||    
35763955 ggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaatttttttttttgtttttggtccctgcaaaattttttgttt 35763856  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
35763855 ttgaaaatagtccct 35763841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 101 - 194
Target Start/End: Complemental strand, 19321862 - 19321769
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    ||||||||||||||| |||||||| |||||||||||| | ||||||||||||||||||||         |||||||||||||||||||||||||    
19321862 attggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaat 19321769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 44925485 - 44925598
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || |||||||||||||| ||||||||||||||| | ||         ||||||||||||||||| ||||||||||||||||    
44925485 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtctcagtaaaaaaaa-ttgttgtttttggtccccgcaaaatattttgttt 44925583  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
44925584 ttgaaaatagtccct 44925598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 4279336 - 4279220
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||| ||| ||||||||||| || |||||||||||||||| |||          | |||||||||||||| |||||||||||||||    
4279336 tggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgtaataaggaaattttgtttttggtcccagcaaaatattttgtt 4279237  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||| ||||    
4279236 tttgaaaatagtacctg 4279220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 25424312 - 25424224
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||||||    
25424312 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 25424224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 103 - 200
Target Start/End: Complemental strand, 53308069 - 53307973
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||| |||||||| |||||||||||||  ||||||||||||||||||||         |||||||||||||||||||||||||||||||    
53308069 tggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttg 53307973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 6827874 - 6827759
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
6827874 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 6827775  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
6827774 ttgaaaatagtccctg 6827759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 36702000 - 36702114
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| |||||||||||||         || |||||||| ||||||||||||| ||||||||    
36702000 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaatttttgttt-ttgtttttagtccctgcaaaattttttgttt 36702098  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
36702099 ttgaaaatagtccctg 36702114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 52017870 - 52017755
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | |||||||| ||||||||||||| ||||||||    
52017870 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttagtccctgcaaaattttttgttt 52017771  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
52017770 ttgaaaatagtccctg 52017755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 9289266 - 9289380
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
9289266 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 9289365  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
9289366 ttgaaaatagtccct 9289380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 106 - 218
Target Start/End: Original strand, 9445951 - 9446060
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| ||||||||||    
9445951 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaattttttgttttt 9446047  T
206 ggaaatagtccct 218  Q
    | |||||||||||    
9446048 gaaaatagtccct 9446060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 29420537 - 29420427
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||| |         || ||||||||  |||||||||||||||||||||    
29420537 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctat-aattttttttattgttttttatccctgcaaaatattttgttt 29420439  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
29420438 ttgaaaatagtc 29420427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 13073757 - 13073815
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||    
13073757 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 13073815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 205
Target Start/End: Original strand, 2322094 - 2322194
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||||||| || |||||||| || |||||||||||||| |||||         ||||||||||||||||||||| |||||||||||||    
2322094 gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgtaaaaaatttttgttgtttttggtccctgcagaatattttgtttt 2322193  T
205 t 205  Q
    |    
2322194 t 2322194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 9446323 - 9446210
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||| |||||||||| ||||||||||| ||||||||          |  ||||||||||||||||||||| ||||||||    
9446323 ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgtaaaaaaaaaat--tgtttttggtccctgcaaaattttttgttt 9446226  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
9446225 ttgaaaatagtccctg 9446210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 14488187 - 14488099
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||||||  |||||||||||||||||||         |||||||||||||||||||||||    
14488187 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 14488099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 22099542 - 22099658
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| ||||||||||| || |||||||||||||||| |||          | ||||||||||||| |||||||| |||||||    
22099542 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattttgtttttggtccatgcaaaattttttgtt 22099641  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
22099642 tttgaaaatagtccctg 22099658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 25358542 - 25358485
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||    
25358542 ttggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg 25358485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 35119611 - 35119499
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||| ||||| | |         |||||||||||||||| |||||||||||||  ||    
35119611 ggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtccgtataaaacaaatttgttgtttttggtccttgcaaaatattttactt 35119512  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
35119511 ttgaaaatagtcc 35119499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 43231088 - 43231176
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
43231088 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa 43231176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 50714566 - 50714451
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||             |||||||||||||||||||||| |||||||    
50714566 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaaaaaaaaattgtttttggtccctgcaaaattttttgtt 50714468  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
50714467 tttgaaaatagtccctg 50714451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 7642652 - 7642596
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||| |||||||||||||||||| | ||||||||||||||||||||    
7642652 ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgt 7642596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 41619902 - 41620013
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| ||| ||||||||||| || |||||||||||||||||||           | |||||||||||||||||||||| |||||||||||    
41619902 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattttgtttttggtccctgcaaaattttttgtttttg 41620001  T
207 gaaatagtccct 218  Q
     |||||||||||    
41620002 aaaatagtccct 41620013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 45593586 - 45593474
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||||||||||||||||| |||||||||||||| |||||            |||||||||||||||||||||| ||||||||    
45593586 ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaa--attgtttttggtccctgcaaaattttttgttt 45593489  T
204 ttggaaatagtccct 218  Q
    ||| || ||||||||    
45593488 ttgaaattagtccct 45593474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 14791806 - 14791751
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
14791806 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 14791751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 23245229 - 23245319
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
23245229 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 23245319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 26412586 - 26412496
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
26412586 ttggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 26412496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 35464384 - 35464294
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
35464384 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 35464294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 5203000 - 5203046
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||    
5203000 ttgtttttggtccgtgcaaaatattttgtttttggaaatagtccctg 5203046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 5827653 - 5827711
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||||||| ||||||||||||||  |||||||||||||||||||    
5827653 ttggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt 5827711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 16712691 - 16712579
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||| ||||||||| ||||||||    
16712691 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtctctgcaaaattttttgttt 16712595  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
16712594 ttgtaaatagtccctg 16712579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 38054549 - 38054659
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          |  ||||||||||||||||||||| |||||||||||    
38054549 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaat--tgtttttggtccctgcaaaattttttgtttttg 38054646  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
38054647 aaaatagtccctg 38054659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 41324892 - 41324834
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| ||||| |||||||||||||| || ||||||||||||||||||||    
41324892 ttggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgt 41324834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 42824093 - 42824039
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||||| |||||||| ||||||||||||||||||||| |||||||||    
42824093 ttggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc 42824039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 103 - 192
Target Start/End: Complemental strand, 42848392 - 42848303
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
42848392 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa 42848303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 2322432 - 2322344
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||| || |||||||||||||| |||||||||||||| |||||         |||||||||||||||||||||||    
2322432 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgtaaattgtttttgttgtttttggtccctgcaaa 2322344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 12152493 - 12152405
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||| ||||||||         |||||||||||||| ||||||||    
12152493 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgtaatttttatttgttgtttttggttcctgcaaa 12152405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 12791678 - 12791723
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||||||||||||||| |||||||||||    
12791678 ttgtttttggtccctgcaaaatattttgtttttgaaaatagtccct 12791723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 96 - 192
Target Start/End: Original strand, 13530371 - 13530467
Alignment:
96 ttcaaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||| |||||||||||| ||||| || |||||||||||||| |||||| ||||||||||||          |||||||||||||||||||||||    
13530371 ttcaaataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaaaagaatttgttgtttttggtccctgcaaa 13530467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 13631599 - 13631511
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
13631599 ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 13631511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 52430100 - 52429989
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||| ||||||||||||||            |||||||||||||||||||||  ||||||||    
52430100 ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaaatttttgttt 52430004  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
52430003 ttgaaaatagtccct 52429989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 5827973 - 5827917
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||    
5827973 ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgt 5827917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 218
Target Start/End: Original strand, 7639897 - 7640007
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||||||| || |||||||||||||||||||||||| || ||||            ||| ||||||||||||||||||| ||||||||    
7639897 gctaaaatatggttttggtccctacaaatatgtcttgttttggttttaatctctgtaaaaaaaaa---ttggttttggtccctgcaaaatactttgtttt 7639993  T
205 tggaaatagtccct 218  Q
    || |||||||||||    
7639994 tgaaaatagtccct 7640007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 12791974 - 12791918
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||    
12791974 ggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgt 12791918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 13479611 - 13479555
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
13479611 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 13479555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 13764613 - 13764669
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||| |||||||||    
13764613 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgt 13764669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 106 - 212
Target Start/End: Complemental strand, 18831176 - 18831072
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||| ||| ||| |||||||||||||||||||||||||||||||            |||||||||||||||||||||| ||||||||||    
18831176 ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgtaaaaaaaaa--attgtttttggtccctgcaaaattttttgttttt 18831079  T
206 ggaaata 212  Q
    | |||||    
18831078 gaaaata 18831072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 29463913 - 29463799
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||| ||||||||            |||||||||||||||||||||| ||||||||    
29463913 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 29463815  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
29463814 ttgaaaatagtccctg 29463799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 31812213 - 31812157
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||  |||||||||||||| ||||||||||||||||||||    
31812213 ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt 31812157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 45505600 - 45505656
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| |||||||||||||||||||||||    
45505600 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 45505656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 53716921 - 53716973
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||||||||||||||||||||||    
53716921 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc 53716973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 218
Target Start/End: Complemental strand, 53717175 - 53717060
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            ||||||||| |||||||||||| |||||||    
53717175 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttgatccctgcaaaattttttgtt 53717076  T
203 tttggaaatagtccct 218  Q
    |||  |||||||||||    
53717075 ttttaaaatagtccct 53717060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 219
Target Start/End: Complemental strand, 55482470 - 55482356
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||||||||| ||| || |||||||| || ||||||||||||||||||||            ||||||||||| |||| ||||| ||||||    
55482470 ttggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggttcctgtaaaattttttgt 55482374  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
55482373 ttttgaaaatagtccctg 55482356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 109 - 160
Target Start/End: Original strand, 2034544 - 2034595
Alignment:
109 aaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||| ||||||||||| || ||||||||||||||||||||    
2034544 aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt 2034595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 11285504 - 11285559
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||    
11285504 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 11285559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 13631389 - 13631350
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
13631389 ggtccctgcaaaatattttgtttttggaaatagtccctgc 13631350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 22584607 - 22584499
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||| || |||| |||||||||||||||  | ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
22584607 ggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaattttttgttt 22584512  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
22584511 ttgaaaatagtcc 22584499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 29499336 - 29499297
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
29499336 ggtccctgcaaaatattttgtttttggaaatagtccctgc 29499297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 30046638 - 30046677
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
30046638 ggtccctgcaaaatattttgtttttggaaatagtccctgc 30046677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 30060979 - 30061018
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
30060979 ggtccctgcaaaatattttgtttttggaaatagtccctgc 30061018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 31560541 - 31560580
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
31560541 ggtccctgcaaaatattttgtttttggaaatagtccctgc 31560580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 35464172 - 35464133
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
35464172 ggtccctgcaaaatattttgtttttggaaatagtccctgc 35464133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 36050289 - 36050344
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||||||| | |||||||||||| ||||||||||||||||||||    
36050289 gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgt 36050344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 219
Target Start/End: Complemental strand, 36702362 - 36702248
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||  ||||| ||||| || ||||||||||||||||||||            |||||||||||||||||||||| |||||||||    
36702362 gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgtaaagagaaaaatttgtttttggtccctgcaaaattttttgtttt 36702263  T
205 tggaaatagtccctg 219  Q
    || ||||||||||||    
36702262 tgaaaatagtccctg 36702248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 44925844 - 44925789
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||||||||| ||||||||| || ||||||||||||||||||||    
44925844 gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgt 44925789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 46088060 - 46088005
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||    
46088060 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 46088005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 46115568 - 46115529
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
46115568 ggtccctgcaaaatattttgtttttggaaatagtccctgc 46115529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 46128702 - 46128663
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
46128702 ggtccctgcaaaatattttgtttttggaaatagtccctgc 46128663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 209
Target Start/End: Complemental strand, 46292651 - 46292545
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnntt-gttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||| ||| ||||||||||| ||  |||||||||||||| ||||         || || ||||||||||||||||||||||||||||    
46292651 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgtaaaaaaaaatttgtagtttttggtccctgcaaaatattttgtt 46292552  T
203 tttggaa 209  Q
    |||||||    
46292551 tttggaa 46292545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 99 - 215
Target Start/End: Original strand, 52441758 - 52441870
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||| |||||||||||||| |||||| |||||||||||||            |||||||||||||||||||||| |||    
52441758 aaataggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaattttt 52441853  T
199 tgtttttggaaatagtc 215  Q
    |||||||  ||||||||    
52441854 tgttttttaaaatagtc 52441870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 220
Target Start/End: Original strand, 54208483 - 54208577
Alignment:
126 ctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||| ||  |||||||||||||||||||         ||||||||||||||| ||||||||||||||| ||||| ||||||| |||||    
54208483 ctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtctctgcaaaatattttgattttgaaaatagttcctgc 54208577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 5882552 - 5882663
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||         ||||   |||||||||||||||||| ||||||||    
5882552 ggctaaaatatggttttagtc-ctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgt---ttttggtccctgcaaaattttttgttt 5882647  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
5882648 ttaaaaatagtccctg 5882663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 13064159 - 13064271
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||| |||||||||||||         ||||   |||||||||| ||||||| ||||||||    
13064159 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgt---ttttggtccccgcaaaattttttgttt 13064255  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
13064256 ttgtaaatagtccctg 13064271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 20144731 - 20144618
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||   |||||||||| || ||||||||||||  ||||||         ||||||||||||||||||||||||| ||||| ||    
20144731 ggctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaacccctgtaaaaaaaa-ttgttgtttttggtccctgcaaaatcttttgatt 20144633  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
20144632 ttgaaaatagtccct 20144618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 23779032 - 23779078
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
23779032 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 23779078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 24474963 - 24474909
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||    
24474963 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct 24474909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 29499543 - 29499458
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
29499543 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa 29499458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 213
Target Start/End: Complemental strand, 31182504 - 31182396
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||  |  |||||||||||||| |||||||||| |||||||||         || ||||||| |||||||||||||||||||||||    
31182504 ggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgtaaatttttgtttttgtttt-ggtccctgcaaaatattttgttt 31182406  T
204 ttggaaatag 213  Q
    ||| ||||||    
31182405 ttgaaaatag 31182396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 35415368 - 35415414
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
35415368 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 35415414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 41620187 - 41620141
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
41620187 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 41620141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 41921016 - 41920970
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
41921016 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 41920970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 46087827 - 46087873
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
46087827 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 46087873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 47135781 - 47135866
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||| |||||||||||||||| |||||| ||| |||||||||||||| |||||         |||||||||||||||||||||||    
47135781 taaaacatgattttggtctctgtaaatatatctcgttttggttttagttcctgtaaaaaaaatttgttgtttttggtccctgcaaa 47135866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 50822225 - 50822179
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||| |||||||||||||||||||||||| ||||||||||||    
50822225 ttgtttttgatccctgcaaaatattttgtttttgaaaatagtccctg 50822179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 51708959 - 51708913
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
51708959 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 51708913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 53915893 - 53915931
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||||||||||||||||    
53915893 ggtccctgcaaaatattttgtttttggaaatagtccctg 53915931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 6827615 - 6827660
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||    
6827615 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccct 6827660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 105 - 219
Target Start/End: Original strand, 13479273 - 13479384
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| |||||||||||||| |||||||||||| ||||| |         ||||   |||||||||||| ||||| |||||||||    
13479273 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctataaaaaaaaattgt---ttttggtccctgtaaaattttttgtttt 13479369  T
205 tggaaatagtccctg 219  Q
    || ||||||||||||    
13479370 tgaaaatagtccctg 13479384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 14791502 - 14791614
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgtt-gtttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||| |||||||| ||||||||||| ||  |||||||||||||| ||||         || || ||||||||||| |||||||||||||||||||    
14791502 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaatttttttttttttgtttttggtccttgcaaaatattttgttttt 14791601  T
206 ggaaatagtccct 218  Q
    | || ||||||||    
14791602 gaaattagtccct 14791614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 18205156 - 18205265
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||| |            |||||||||||||||||||||| ||||||||    
18205156 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaa--attgtttttggtccctgcaaaattttttgttt 18205253  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
18205254 ttgaaaatagtc 18205265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 19321570 - 19321658
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||||||||| ||| ||| ||| || |||||||||||||||||||          |||||||||||||||||||||||    
19321570 ggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 19321658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 26412374 - 26412337
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||||||||||||||||||||    
26412374 ggtccctgcaaaatattttgtttttggaaatagtccct 26412337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 28448897 - 28448942
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||| |||||||||||||||||||||||||||||||| ||||||||    
28448897 ttgtagtttttggtccctgcaaaatattttgtttttgaaaatagtc 28448942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 31370964 - 31370919
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||    
31370964 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccct 31370919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 46115779 - 46115691
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||| ||| ||||||||| |||| |||||||||||||||||||          |||||||||||||||||||||||    
46115779 ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 46115691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 46128913 - 46128825
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||| ||| ||||||||| |||| |||||||||||||||||||          |||||||||||||||||||||||    
46128913 ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 46128825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 53915683 - 53915771
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||| ||||||||||||          |||||||||||||||||||||||    
53915683 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 53915771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 54208822 - 54208769
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||||||| |||||||||||||| ||||||||||||||| ||||    
54208822 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt 54208769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 218
Target Start/End: Original strand, 8904936 - 8904984
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||| ||||||||||||||||||||||||||||| |||||| ||||    
8904936 ttgttgtgtttggtccctgcaaaatattttgtttttgaaaatagcccct 8904984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 13064465 - 13064409
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
13064465 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 13064409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 22099912 - 22099856
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||| ||||    
22099912 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgt 22099856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 67 - 103
Target Start/End: Original strand, 25505313 - 25505349
Alignment:
67 aaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    |||||||||||||||||||||||||||||||||||||    
25505313 aaaaagcttcaattactcttggtcatgaattcaaatt 25505349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 26314332 - 26314276
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||| || ||| |||||||||| ||||||||||||||||||||    
26314332 ggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgt 26314276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 109 - 215
Target Start/End: Complemental strand, 27008401 - 27008297
Alignment:
109 aaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttgga 208  Q
    ||||||| |||| ||||||||||||||| || ||||||||||||||||||||            ||||||||||||| |||||||| ||||||||||| |    
27008401 aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa--attgtttttggtccttgcaaaattttttgtttttgaa 27008304  T
209 aatagtc 215  Q
    |||||||    
27008303 aatagtc 27008297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 29380910 - 29380858
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
29380910 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 29380858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 31811925 - 31811981
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||| || |||||||||||| | ||||||||||||||||||||    
31811925 ggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgt 31811981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 32365094 - 32365208
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||| |||||            |||||||||||||||||||||| ||||||||    
32365094 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 32365192  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
32365193 tttaaaatagtccctg 32365208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 32365483 - 32365427
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
32365483 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt 32365427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 34361803 - 34361855
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
34361803 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 34361855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 211
Target Start/End: Original strand, 41345853 - 41345960
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
41345853 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 41345952  T
204 ttggaaat 211  Q
    ||| ||||    
41345953 ttgaaaat 41345960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 219
Target Start/End: Complemental strand, 45505720 - 45505676
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||| ||||||||||| ||||||||||||    
45505720 gtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 45505676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 46292391 - 46292447
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||| |||||||| ||||||||||| || ||||||||||| |||||||    
46292391 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg 46292447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #147
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 218
Target Start/End: Complemental strand, 50714398 - 50714350
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||| |||||||||||||||||||| ||||||||||| |||||||||||    
50714398 ttgtagtttttggtccctgcaaaattttttgtttttgaaaatagtccct 50714350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #148
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 52017505 - 52017561
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
52017505 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 52017561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #149
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 52442092 - 52442036
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||  ||||||||||||| ||||||||||||||||||||    
52442092 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt 52442036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #150
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 54903475 - 54903419
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| |  ||||||||||||||||||||    
54903475 ggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt 54903419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #151
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 55072389 - 55072504
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||          | ||||||||||||||| |||||  ||||||||    
55072389 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaaatttttgttt 55072488  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
55072489 ttaaaaatagtccctg 55072504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #152
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 4211561 - 4211616
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||| |||||||    
4211561 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg 4211616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #153
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 6353637 - 6353582
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||||||| ||||||||||  || ||||||||||||||||||||    
6353637 gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt 6353582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #154
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 8191076 - 8191131
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||  || || ||||||||||||||||| ||||||||||||||    
8191076 gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgt 8191131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #155
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 9289639 - 9289584
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||| ||||||| |||| ||| |||||||||||||| |||||||||||||||||||    
9289639 ggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 9289584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #156
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 24774216 - 24774177
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||| |||||||||||||    
24774216 ggtccctgcaaaatattttgtttttgaaaatagtccctgc 24774177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #157
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 25358286 - 25358329
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatag 213  Q
    |||| |||||||||||||||||||||||||||||||| ||||||    
25358286 ttgtagtttttggtccctgcaaaatattttgtttttgaaaatag 25358329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #158
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 25424101 - 25424062
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||| |||||||||||||    
25424101 ggtccctgcaaaatattttgtttttgaaaatagtccctgc 25424062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #159
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 218
Target Start/End: Original strand, 27008153 - 27008196
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||| ||||||||||| |||||||||||    
27008153 gtttttggtccctgcaaaattttttgtttttgaaaatagtccct 27008196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #160
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 32208542 - 32208655
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct-gtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||| ||            ||||||||||||||| |||||| |||||||    
32208542 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaa---ttgtttttggtccctacaaaattttttgtt 32208638  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
32208639 tttgaaaatagtccctg 32208655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #161
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 35763647 - 35763702
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
35763647 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 35763702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #162
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 219
Target Start/End: Complemental strand, 41346147 - 41346104
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||| ||||||||||| ||||||||||||    
41346147 tttttggtccctgcaaaattttttgtttttgaaaatagtccctg 41346104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #163
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 47023105 - 47023050
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| ||||| || |||||||||||| | |||||||||||||||||||    
47023105 ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg 47023050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #164
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 5063295 - 5063249
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||  ||||||||||||    
5063295 ttgtttttggtccctgcaaaattttttgtttttaaaaatagtccctg 5063249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #165
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 5797817 - 5797732
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| || ||||||||||| |||||||||||| ||||||          |||||||||||||||||||||||    
5797817 taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctgcaaaaaaaaattgttgtttttggtccctgcaaa 5797732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #166
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 16712400 - 16712446
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||| ||||||    
16712400 ttgtttttggtccctgcaaaattttttgtttttgaaaataatccctg 16712446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #167
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 18205521 - 18205467
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||    
18205521 ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 18205467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #168
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 26313986 - 26314044
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| ||||| || ||||||||||||   ||||||||||||||||||||    
26313986 ttggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgt 26314044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #169
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 27427915 - 27427957
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||| ||||||||||||||||||||||||| ||||||||||||    
27427915 ttttagtccctgcaaaatattttgtttttgaaaatagtccctg 27427957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #170
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 28809009 - 28809067
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||| |||  ||||||||||| | ||||||||||||||||||||    
28809009 ttggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgt 28809067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #171
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 30060772 - 30060857
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| ||||||||||| || |||||| ||||||||||||          |||||||||||||||||||||||    
30060772 taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctgcaatatttttttgttgtttttggtccctgcaaa 30060857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #172
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 91 - 192
Target Start/End: Original strand, 31560318 - 31560419
Alignment:
91 atgaattcaaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgca 190  Q
    ||||||| |||  |||||||||||| ||||| || |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||    
31560318 atgaatttaaaaaggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgca 31560417  T
191 aa 192  Q
    ||    
31560418 aa 31560419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #173
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 35420393 - 35420447
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||||||| | |||||||||  ||||||||||||||||||||||    
35420393 ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgt 35420447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #174
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 43368467 - 43368521
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||| ||| |||||||||||| | ||||||||||||||||||||    
43368467 ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 43368521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #175
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 51830891 - 51830945
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||  |||| ||| ||||| |||||||||||||||||||||||||||||    
51830891 ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgt 51830945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #176
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 55482173 - 55482215
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||| ||||||||    
55482173 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtc 55482215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #177
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 123529 - 123648
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||| ||||||||||| ||  ||||||||||||||||||             ||||||||||||||||| |||| |||    
123529 aaataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgc-aaattttt 123627  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||    
123628 tgtttttgaaaatagtccctg 123648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #178
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 9289472 - 9289509
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||||||| |||||||||||    
9289472 ggtccctgcaaaatattttgtttttgaaaatagtccct 9289509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #179
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 27008083 - 27008140
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||  |||| ||| ||||||||||| || ||||||||||||||||||||    
27008083 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt 27008140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #180
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 219
Target Start/End: Complemental strand, 32208834 - 32208789
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| |||||| ||||||||||| ||||||||||||    
32208834 tgtttttggtccctacaaaattttttgtttttgaaaatagtccctg 32208789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #181
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 45505894 - 45505778
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt-nnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||| |||||          || |||||||||||||||||||| | |||||||    
45505894 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaattttttttttttgtttttggtccctgcaaatttttttgtt 45505795  T
203 tttggaaatagtccctg 219  Q
    |||  || |||||||||    
45505794 ttttaaattagtccctg 45505778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #182
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 50714238 - 50714295
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| |||| ||| ||||||||||| ||  ||||||||||||||||||    
50714238 ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 50714295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #183
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 51545966 - 51545913
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
51545966 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 51545913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #184
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 2034855 - 2034799
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| | ||||||||| || ||||||||||||||||||||    
2034855 ggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgt 2034799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #185
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 2180220 - 2180276
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| ||  |||||||||||||||||||    
2180220 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt 2180276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #186
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 4279022 - 4279078
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| | | |||||||||| ||| ||||||||||||||||||||    
4279022 ggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgt 4279078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #187
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 5203082 - 5203046
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||| ||||||||||||||||||||||||||||    
5203082 ggtccctgtaaaatattttgtttttggaaatagtccc 5203046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #188
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 192
Target Start/End: Complemental strand, 5203272 - 5203205
Alignment:
125 tctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||||||||||||||||||||| ||          |||||||||||||||||||||||    
5203272 tctgcaaatatgtcttgttttggttttagtccttgcaaattatttttgttgtttttggtccctgcaaa 5203205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #189
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 8760604 - 8760660
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||  ||||  || |||||||||||||| ||||||||||||||||||||    
8760604 ggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgt 8760660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #190
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 8760781 - 8760725
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||  |||||||||| || ||||||||||||||||||||    
8760781 ggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgt 8760725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #191
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 12152154 - 12152210
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||  ||||||||||||||    
12152154 ggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgt 12152210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #192
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 14487976 - 14487940
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||||||| ||||||||||    
14487976 ggtccctgcaaaatattttgtttttgaaaatagtccc 14487940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #193
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 14594206 - 14594258
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||||||| ||||||||||||||   ||||||||||||||    
14594206 ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc 14594258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #194
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 14594561 - 14594509
Alignment:
108 aaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| ||| || ||||||| |||||||||||||||||| |||||    
14594561 aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgt 14594509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #195
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 159
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
15555506 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 15555558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #196
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 18135856 - 18135896
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||| ||||||||||| |||||||||    
18135856 tttttggtccctgcaaaattttttgtttttgaaaatagtcc 18135896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #197
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 22584287 - 22584343
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||  ||||||||||||| ||||||||||||||| ||||    
22584287 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgt 22584343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #198
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 27572550 - 27572634
Alignment:
19 tatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    ||||||| |||||||||||||  ||||  ||||| |||||  ||   ||||| |||||||||||||||| |||||||||||||||    
27572550 tatatgacagataaattatagatattttgataacttaactaattaccaaaaatgcttcaattactcttgttcatgaattcaaatt 27572634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #199
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 35119292 - 35119348
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||    ||||||||||||||||||||    
35119292 ggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgt 35119348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #200
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 36054150 - 36054094
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| | |||||||| ||||||||||| ||  |||||||||||||||||||    
36054150 ggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgt 36054094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #201
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 206
Target Start/End: Original strand, 37556909 - 37556945
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||| ||||||||||||||||||||||||    
37556909 ttgttgtttttgatccctgcaaaatattttgtttttg 37556945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #202
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 192
Target Start/End: Complemental strand, 37557194 - 37557107
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||| |||||||| ||||||||||  || |||||| |||||||||||||         |||||||||||||||||| ||||    
37557194 gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgtaatttttttttgttgtttttggtccctccaaa 37557107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #203
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 41346218 - 41346166
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| ||||||||||||||  |||||||||||||||    
41346218 ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc 41346166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #204
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 135
Target Start/End: Original strand, 41933813 - 41933849
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatat 135  Q
    |||| ||||||||||||||||||||||||||||||||    
41933813 aaataggctaaaatatgattttggtctctgcaaatat 41933849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #205
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 214
Target Start/End: Original strand, 46292513 - 46292545
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||||||||||||||    
46292513 gtccctgcaaaatattttgtttttggaaatagt 46292545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #206
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 49123064 - 49123104
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||| ||||||||||| |||||||||    
49123064 tttttggtccctgcaaaattttttgtttttgaaaatagtcc 49123104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #207
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 52543422 - 52543470
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||||| ||||||||  ||||||||||||| ||||||||||||    
52543422 ggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 52543470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #208
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 218
Target Start/End: Original strand, 54903177 - 54903225
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||| |||| ||||||||||||||||||  |||||||||||    
54903177 ttgttgtttttgatccccgcaaaatattttgttttttaaaatagtccct 54903225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #209
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 2180406 - 2180371
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
2180406 ttgtagtttttggtccctgcaaaatattttgttttt 2180371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #210
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 219
Target Start/End: Complemental strand, 2180502 - 2180459
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||| ||||||||||  ||||||||||||    
2180502 tttttggtccctgcaaaattttttgttttttaaaatagtccctg 2180459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #211
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 4279167 - 4279132
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
4279167 ttgtagtttttggtccctgcaaaatattttgttttt 4279132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #212
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 158
Target Start/End: Original strand, 5202922 - 5202981
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttg-ttttggttttagtccct 158  Q
    |||||| ||||||||| |||||||| ||||||||||| || | |||||||||||||||||    
5202922 aattggttaaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct 5202981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #213
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 6827706 - 6827671
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
6827706 ttgtagtttttggtccctgcaaaatattttgttttt 6827671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #214
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 52 - 103
Target Start/End: Complemental strand, 9363327 - 9363276
Alignment:
52 cataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    |||||||| |||  ||||| || |||||||||||||||||||||||||||||    
9363327 cataactgattgccaaaaaggcctcaattactcttggtcatgaattcaaatt 9363276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #215
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 9446157 - 9446122
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
9446157 ttgtagtttttggtccctgcaaaatattttgttttt 9446122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #216
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 11285670 - 11285705
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
11285670 ttgtagtttttggtccctgcaaaatattttgttttt 11285705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #217
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 13479437 - 13479472
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
13479437 ttgtagtttttggtccctgcaaaatattttgttttt 13479472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #218
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 18205322 - 18205357
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
18205322 ttgtagtttttggtccctgcaaaatattttgttttt 18205357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #219
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 20878872 - 20878907
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
20878872 ttgtagtttttggtccctgcaaaatattttgttttt 20878907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #220
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 23245441 - 23245480
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||| ||||| |||||||||||||    
23245441 ggtccctgcaaaatattttgattttgaaaatagtccctgc 23245480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #221
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 103
Target Start/End: Original strand, 23464244 - 23464319
Alignment:
28 gataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    |||||||||||| |||||||||||| ||| || || ||| ||| |  | |||||||||| ||||||||||||||||    
23464244 gataaattatagacatttgcataacttaattgattattagaaaggtcttaattactcttagtcatgaattcaaatt 23464319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #222
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Original strand, 24474669 - 24474712
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||| |||||||||||| ||||||||||| |||||||||    
24474669 ttgtttttgatccctgcaaaattttttgtttttgaaaatagtcc 24474712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #223
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 27428010 - 27428045
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
27428010 ttgtagtttttggtccctgcaaaatattttgttttt 27428045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #224
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 218
Target Start/End: Complemental strand, 28449014 - 28448979
Alignment:
183 tccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||||| ||||||||||||    
28449014 tccctgcaaaatattttgtttttagaaatagtccct 28448979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #225
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 214
Target Start/End: Complemental strand, 28449148 - 28449117
Alignment:
183 tccctgcaaaatattttgtttttggaaatagt 214  Q
    ||||||||||||||||||||||||||||||||    
28449148 tccctgcaaaatattttgtttttggaaatagt 28449117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #226
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 29380668 - 29380723
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||  |||| ||| |||||||||||||| ||||||||||| |||||||    
29380668 ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg 29380723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #227
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 32208708 - 32208743
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
32208708 ttgtagtttttggtccctgcaaaatattttgttttt 32208743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #228
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 38054712 - 38054747
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
38054712 ttgtagtttttggtccctgcaaaatattttgttttt 38054747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #229
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 41316078 - 41316113
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
41316078 ttgtagtttttggtccctgcaaaatattttgttttt 41316113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #230
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 217
Target Start/End: Original strand, 41439999 - 41440034
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    ||||||||||||||||||||||||| ||||||||||    
41439999 gtccctgcaaaatattttgtttttgaaaatagtccc 41440034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #231
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 41920917 - 41920882
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
41920917 ttgtagtttttggtccctgcaaaatattttgttttt 41920882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #232
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 42306083 - 42306118
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
42306083 ttgtagtttttggtccctgcaaaatattttgttttt 42306118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #233
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 42848181 - 42848142
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||| ||||| |||||||||||||    
42848181 ggtccctgcaaaatattttgattttgaaaatagtccctgc 42848142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #234
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 45593392 - 45593427
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
45593392 ttgtagtttttggtccctgcaaaatattttgttttt 45593427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #235
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 46087924 - 46087959
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
46087924 ttgtagtttttggtccctgcaaaatattttgttttt 46087959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #236
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Original strand, 51545696 - 51545739
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||||||||||||| ||||||||||  |||||||||    
51545696 ttgtttttggtccctgcaaaattttttgttttttaaaatagtcc 51545739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #237
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 51708693 - 51708744
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||    
51708693 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc 51708744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #238
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 51708860 - 51708825
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
51708860 ttgtagtttttggtccctgcaaaatattttgttttt 51708825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #239
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 54208615 - 54208576
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||| |||||||||||||||||||| |||||||||||||    
54208615 ggtccttgcaaaatattttgtttttgaaaatagtccctgc 54208576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #240
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 55893390 - 55893425
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
55893390 ttgtagtttttggtccctgcaaaatattttgttttt 55893425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #241
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 123823 - 123781
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||| ||||||| ||| |||||||||||    
123823 tttttggtccctgcaaaattttttgttcttgaaaatagtccct 123781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #242
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 3178755 - 3178797
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||| | ||||||||||| ||||||||||||    
3178755 ttttggtccctgcaaatttttttgtttttgaaaatagtccctg 3178797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #243
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 8191393 - 8191335
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||| ||| ||||||||||| || |||| ||||| |||||||||    
8191393 ttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt 8191335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #244
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 9289435 - 9289465
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
9289435 gtttttggtccctgcaaaatattttgttttt 9289465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #245
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 212
Target Start/End: Original strand, 13530560 - 13530590
Alignment:
182 gtccctgcaaaatattttgtttttggaaata 212  Q
    |||||||||||||||||||||||||||||||    
13530560 gtccctgcaaaatattttgtttttggaaata 13530590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #246
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||||  |||| ||| |||||||||||||| |||||||||||||||    
15555637 gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc 15555587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #247
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 18830913 - 18830955
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||| | ||||||||||| ||||||||    
18830913 ttgtttttggtccctgcaaatttttttgtttttgaaaatagtc 18830955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #248
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 192
Target Start/End: Original strand, 19903256 - 19903349
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||| |||||||||||  ||||| || ||||||||||||||  ||||| |||||||||||||         |||||||||||| ||||||||||    
19903256 aaataggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgtaattttttgttgttgtttttgatccctgcaaa 19903349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #249
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Original strand, 20144492 - 20144534
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| |||||||||||||| ||||||||||| |||||||    
20144492 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 20144534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #250
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 22099703 - 22099665
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
22099703 ggtccctgcaaaattttttgtttttgaaaatagtccctg 22099665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #251
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 23254568 - 23254538
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
23254568 gtttttggtccctgcaaaatattttgttttt 23254538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #252
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 23778964 - 23779014
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||    
23778964 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 23779014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #253
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 216
Target Start/End: Complemental strand, 25424069 - 25424035
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||||||||| |||||||||    
25424069 gtccctgcaaaatattttgtttttgaaaatagtcc 25424035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #254
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 190 - 220
Target Start/End: Complemental strand, 26412336 - 26412306
Alignment:
190 aaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||||||||    
26412336 aaaatattttgtttttggaaatagtccctgc 26412306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #255
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 28809180 - 28809126
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| ||| |||||||||||  | ||||||||||||||||||    
28809180 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct 28809126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #256
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 41346010 - 41345972
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
41346010 ggtccctgcaaaattttttgtttttgaaaatagtccctg 41345972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #257
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 42306125 - 42306163
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
42306125 ggtccctgcaaaattttttgtttttgaaaatagtccctg 42306163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #258
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 135
Target Start/End: Original strand, 44705296 - 44705330
Alignment:
101 attggctaaaatatgattttggtctctgcaaatat 135  Q
    ||||||||||||||| |||||||||||||||||||    
44705296 attggctaaaatatgtttttggtctctgcaaatat 44705330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #259
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 50754182 - 50754140
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||| ||| |||||||||||||||||||||||||| |||||||    
50754182 tttttgtccctgcaaatatgtcttgttttggttttggtccctg 50754140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #260
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 220
Target Start/End: Complemental strand, 50822131 - 50822081
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||| ||||||| |||||||||||||||||||||||  ||| |||||||||    
50822131 ttgtagtttttgatccctgcaaaatattttgtttttaaaaaaagtccctgc 50822081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #261
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 220
Target Start/End: Complemental strand, 55482303 - 55482253
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||| ||||||||||||| |||||||||||||||||  ||| |||||||||    
55482303 ttgtagtttttggtccctacaaaatattttgtttttaaaaaaagtccctgc 55482253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #262
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 103 - 192
Target Start/End: Complemental strand, 55805089 - 55805000
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||  |||||||   |||||||||| ||||||||||||||||||| ||          |||||||||||||||||||||||    
55805089 tggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtccatgcaaattttttttgttgtttttggtccctgcaaa 55805000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #263
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 5052517 - 5052476
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||| ||||||||||||| ||||||||||| |||||||    
5052517 ttgtttttagtccctgcaaaattttttgtttttgaaaatagt 5052476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #264
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 13479479 - 13479516
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
13479479 ggtccctgcaaaattttttgtttttgaaaatagtccct 13479516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #265
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 158
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||| |||||||||||||| ||||||||||| ||||||    
14594494 ttttggtccctgcaaatatgtctcgttttggttttggtccct 14594453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #266
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 16712484 - 16712447
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
16712484 ggtccctgcaaaattttttgtttttgaaaatagtccct 16712447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #267
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 20144423 - 20144476
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||||||| ||||||||||| || ||||| ||||||| ||||||    
20144423 taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctgt 20144476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #268
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 22204053 - 22204110
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| |||||||| ||||||||||  |  |||| ||||||||||||||    
22204053 ttggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg 22204110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #269
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 23254531 - 23254494
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
23254531 ggtccctgcaaaattttttgtttttgaaaatagtccct 23254494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #270
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 31182335 - 31182368
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||||||| |||||||    
31182335 ggtccctgcaaaatattttgtttttgaaaatagt 31182368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #271
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 32365416 - 32365371
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||  ||||||||||  |||||||||||    
32365416 ttgtttttggtccctgcaaaaatttttgttttttaaaatagtccct 32365371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #272
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 34355288 - 34355227
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| |||||||||||| |||| ||| ||  ||||||| || ||||||||||||||||||||    
34355288 aaataggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgt 34355227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #273
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 34361936 - 34361899
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
34361936 ggtccctgcaaaattttttgtttttgaaaatagtccct 34361899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #274
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 191 - 220
Target Start/End: Original strand, 47532521 - 47532550
Alignment:
191 aaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||    
47532521 aaatattttgtttttggaaatagtccctgc 47532550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #275
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 51708818 - 51708781
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
51708818 ggtccctgcaaaattttttgtttttgaaaatagtccct 51708781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #276
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 52429921 - 52429958
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
52429921 ggtccctgcaaaattttttgtttttgaaaatagtccct 52429958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #277
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 158
Target Start/End: Complemental strand, 54903403 - 54903362
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||| |||||||||||||| ||||||||||| ||||||    
54903403 ttttggtccctgcaaatatgtctcgttttggttttggtccct 54903362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #278
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 55072709 - 55072656
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||| ||| ||||||||||| || |||||||||||| |||||||    
55072709 taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt 55072656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #279
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 2034781 - 2034741
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||| ||||||||||||||  ||||||||||||||||    
2034781 ttttggtccctgcaaatatgtctcattttggttttagtccc 2034741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #280
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 4211783 - 4211748
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||||||| ||||||||||||||||||||    
4211783 ttgttgtttttggtcc-tgcaaaatattttgtttttg 4211748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #281
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 5052584 - 5052532
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||| |||||| |||| ||| ||||||||||| || ||||||||||||||||    
5052584 ggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 5052532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #282
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 8904886 - 8904934
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||||  |||||||| ||||||||||| || ||||||||||||    
8904886 ggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta 8904934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #283
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 201
Target Start/End: Complemental strand, 9289571 - 9289543
Alignment:
173 ttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||||||||||||||||||    
9289571 ttgtttttggtccctgcaaaatattttgt 9289543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #284
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Complemental strand, 11285794 - 11285754
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||| |||||| ||||||||||| |||||||||    
11285794 tttttggtccctacaaaattttttgtttttgaaaatagtcc 11285754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #285
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 18136113 - 18136057
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| |||  || || |||||||| || ||||||||||||||||||||    
18136113 ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt 18136057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #286
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 22851348 - 22851249
Alignment:
1 tggttataagtatattactatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaa 100  Q
    ||||||||||||||| |   |||||||||||||  | || ||||||||||   |||||| ||   ||||| ||||||||||||||||||||||| | |||    
22851348 tggttataagtatatca---tatgatagataaacaacagacatttgcatagtttaactgattaccaaaaaggcttcaattactcttggtcatgattccaa 22851252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #287
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 28449214 - 28449166
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||||| ||||||||  ||||||||||||| |||||| |||||    
28449214 ggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta 28449166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #288
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 213
Target Start/End: Complemental strand, 36050518 - 36050482
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatag 213  Q
    |||||||||||||||||||| ||||||||| ||||||    
36050518 ttttggtccctgcaaaatatcttgtttttgaaaatag 36050482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #289
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 41921084 - 41921032
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| | | |||||||||||| | ||||||||||||||||    
41921084 ggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc 41921032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #290
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 219
Target Start/End: Original strand, 45593296 - 45593340
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||  ||||||||||  ||||||||||||    
45593296 gtttttggtccctgcaaaaatttttgttttttaaaatagtccctg 45593340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #291
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 47274232 - 47274180
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||||  |||| ||  |||||||||||||| ||||||||||||||    
47274232 ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 47274180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #292
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 49123321 - 49123265
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| |||  || || |||||||| || ||||||||||||||||||||    
49123321 ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt 49123265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #293
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 51545629 - 51545685
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||  || ||||||||||||||| ||||    
51545629 ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgt 51545685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 244)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 25705085 - 25705201
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
25705085 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 25705184  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
25705185 ttggaaatagtccctgc 25705201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 146691 - 146574
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| |||||||||||| | ||||||||||||||||||||         |||||||||||||||||||||||||||||||||    
146691 tggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt 146592  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
146591 tttggaaatagtccctgc 146574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 29859872 - 29859756
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
29859872 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaatttttgttgtttttggtccctgcaaaatattttgttt 29859773  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
29859772 ttggaaatagtccctgc 29859756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 43672318 - 43672204
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||         || |||||||||||||||||||||||||||||||    
43672318 ggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaaaaattttttattgtttttggtccctgcaaaatattttgttt 43672219  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
43672218 ttgaaaatagtccct 43672204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 20131682 - 20131565
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||||||||||||    
20131682 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt 20131583  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
20131582 tttggaaatagtccctgc 20131565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 14003742 - 14003626
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
14003742 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttgttt 14003643  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
14003642 ttggaaatagtccctgc 14003626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 15842823 - 15842707
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
15842823 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 15842724  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
15842723 ttggaaatagtccctgc 15842707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 24358616 - 24358732
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
24358616 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatattttgttt 24358715  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
24358716 ttggaaatagtccctgc 24358732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 13215060 - 13215174
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
13215060 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttgttt 13215159  T
204 ttggaaatagtccct 218  Q
    ||  |||||||||||    
13215160 tttaaaatagtccct 13215174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 33575752 - 33575866
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
33575752 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 33575851  T
204 ttggaaatagtccct 218  Q
    |||||||||||||||    
33575852 ttggaaatagtccct 33575866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 1138359 - 1138244
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || |||||||||||||| ||||| ||||||||||||||         ||||||||||||||||||||||||||||||||||    
1138359 ggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaattttttgttgttgtttttggtccctgcaaaatattttgttt 1138260  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
1138259 ttgaaaatagtccctg 1138244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 40125289 - 40125175
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||||||| ||||||||||| ||  |||| ||||||||||||||         ||||||||||||||||||||||||||||||||||    
40125289 ggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 40125190  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
40125189 ttgaaaatagtccct 40125175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 30215871 - 30215754
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnn-ttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||||||| |||||||||| ||  ||||||||||||||||||||          |||||||||||||||||||||||||||||||||    
30215871 ggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt 30215772  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
30215771 tttggaaatagtccctgc 30215754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 2481557 - 2481441
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | |||    
2481557 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattattttt 2481458  T
204 ttggaaatagtccctgc 220  Q
    |||||||| ||||||||    
2481457 ttggaaatcgtccctgc 2481441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 16523325 - 16523211
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||||||||| ||||||||||||| ||    
16523325 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgatt 16523226  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
16523225 ttgaaaatagtccct 16523211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 11788421 - 11788302
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||||||||||||    
11788421 aaataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt-aattttttttgttgtttttggtccctgcaaaatattt 11788323  T
199 tgtttttggaaatagtccctg 219  Q
    || ||||| ||||| ||||||    
11788322 tgcttttgaaaataatccctg 11788302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 18113459 - 18113338
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    ||||||||||||||||| |||||||| || ||||||||  | |||||||||||| |||||||         ||||||||||| |||||||||||||||||    
18113459 aaattggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgtaaattttttttgttgtttttagtccctgcaaaatattt 18113360  T
199 tgtttttggaaatagtccctgc 220  Q
    | |||||| |||||||||||||    
18113359 tctttttgaaaatagtccctgc 18113338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 105 - 218
Target Start/End: Complemental strand, 42696202 - 42696089
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| ||||| || ||||||||||| || |||||||||||||||| |||         |||||||||||| ||||||||||||||||||||||    
42696202 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgtaaaaaaaatttgttgtttttgatccctgcaaaatattttgtttt 42696103  T
205 tggaaatagtccct 218  Q
    || |||||||||||    
42696102 tgaaaatagtccct 42696089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 12835324 - 12835440
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||| ||| ||||||||||| ||  |||||||||||||||||||          | |||||||||||| |||||||||||||||||    
12835324 tggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtctctgcaaaatattttgtt 12835423  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
12835424 tttgaaaatagtccctg 12835440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 3172532 - 3172417
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnntt-gttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||||||  |||||||||| || |||||||||||||||| |||         || ||||||||||||| |||||||||||||||||    
3172532 ggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtccatgtaattttttttttgttgtttttggtctctgcaaaatattttgtt 3172433  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
3172432 tttgaaaatagtccct 3172417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 31644841 - 31644956
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt-nnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||| ||||          ||||||||||| ||||||||||||||| |||||    
31644841 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaattgttgtttttagtccctgcaaaatatcttgtt 31644940  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
31644941 tttgaaaatagtccct 31644956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 101 - 192
Target Start/End: Original strand, 34317795 - 34317886
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||    
34317795 attggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa 34317886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 99 - 192
Target Start/End: Original strand, 42695863 - 42695956
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||| |         |||||||||||||||||||||||    
42695863 aaattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctataattcttttttgttgtttttggtccctgcaaa 42695956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 43597499 - 43597387
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| |||| ||||||||| ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
43597499 ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaattttttgttt 43597403  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
43597402 ttgaaaatagtccctg 43597387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 102 - 194
Target Start/End: Original strand, 23732037 - 23732129
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||||||||||| || |||||||||||||| |||||||||||||||| |||         |||||||||||||||||||||||||    
23732037 ttggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaat 23732129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 103 - 203
Target Start/End: Complemental strand, 36806897 - 36806797
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||| |||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||| ||||||||||||| |||||||||||||    
36806897 tggccaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttatttttggtccctgtaaaatattttgtt 36806798  T
203 t 203  Q
    |    
36806797 t 36806797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 200
Target Start/End: Original strand, 36815488 - 36815584
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||||||||| |||||  ||||| |||||||||| ||||||||||||||||||||         |||||||||||||||||||||||||||||||    
36815488 ggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 36815584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 11713845 - 11713730
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||| | |||| ||| ||||||||||| || ||||||||||||||||||||          | |||||||||||||||||||||| ||||||||    
11713845 ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaataattttgtttttggtccctgcaaaattttttgttt 11713746  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
11713745 ttgaaaatagtccctg 11713730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 19183782 - 19183897
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||           | ||||||||| |||||||||||| ||||||||    
19183782 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttgtttttgatccctgcaaaattttttgttt 19183881  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
19183882 ttgaaaatagtccctg 19183897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 40301975 - 40302090
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| ||  |||| ||||||||||||||          | |||||||||||||||||||||||||||||||    
40301975 ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattttgttt 40302074  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
40302075 ttgaaaatagtccctg 40302090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 40302339 - 40302228
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | |||||||||||||||||||||| ||||||||    
40302339 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtaaacaaaaaattttgtttttggtccctgcaaaattttttgttt 40302240  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
40302239 ttgaaaatagtc 40302228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 195
Target Start/End: Original strand, 44559062 - 44559153
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaata 195  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||| |||||||    
44559062 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttggtccctacaaaata 44559153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 219
Target Start/End: Complemental strand, 3838263 - 3838149
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||          | |||||||||||||||||||||| |||||||||    
3838263 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgtttt 3838164  T
205 tggaaatagtccctg 219  Q
    || ||||||||||||    
3838163 tgaaaatagtccctg 3838149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 194
Target Start/End: Complemental strand, 4424185 - 4424095
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||| |||||||||||||    
4424185 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttagtccctgcaaaat 4424095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 101 - 219
Target Start/End: Original strand, 11713482 - 11713600
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||          | |||||||||| ||||| ||||  |||||    
11713482 attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaacaattttgtttttggcccctgtaaaaatttttg 11713581  T
201 tttttggaaatagtccctg 219  Q
    |||||| ||||||||||||    
11713582 tttttgaaaatagtccctg 11713600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 219
Target Start/End: Complemental strand, 41694005 - 41693888
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||            ||||||||||||| || ||||| ||||||    
41694005 ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaagaaaaaaattgtttttggtccatgtaaaattttttgt 41693906  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
41693905 ttttgaaaatagtccctg 41693888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 4423895 - 4423983
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||    
4423895 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 4423983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 102 - 194
Target Start/End: Original strand, 5334749 - 5334841
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||||    
5334749 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaat 5334841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 18113089 - 18113177
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||    
18113089 ggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 18113177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 20131317 - 20131405
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
20131317 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 20131405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 107 - 218
Target Start/End: Complemental strand, 1696452 - 1696341
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||||| ||| || ||||||||||| |||||||||| | || ||||         |||||||||||||||| |||||||||||||||||||     
1696452 taaaatatgattttcgtcccttcaaatatgtctcgttttggtttcaatctctgtaaaaaatatttgttgtttttggtccatgcaaaatattttgtttttt 1696353  T
207 gaaatagtccct 218  Q
     |||||||||||    
1696352 aaaatagtccct 1696341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 199
Target Start/End: Complemental strand, 16673771 - 16673676
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatttt 199  Q
    |||||||||||| |||||||| ||||||||||| || ||||| |||||||||||||          ||||||||||||||||||||||||||||||    
16673771 ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatttt 16673676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 199
Target Start/End: Original strand, 32476095 - 32476190
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatttt 199  Q
    |||||||||||| ||||| || ||||||||||| ||  |||||||||||||||||||         ||||||||||||||||||||||||||||||    
32476095 ggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatttt 32476190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 37910756 - 37910871
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| ||  |||||||||| ||  |||| ||||||||||||||         ||||||||||||||||||||||||||||||||||    
37910756 ggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaaaaaaaa-ttgttgtttttggtccctgcaaaatattttgttt 37910854  T
204 ttggaaatagtccctgc 220  Q
    ||| |||||||| ||||    
37910855 ttgaaaatagtcgctgc 37910871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 20939324 - 20939269
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||    
20939324 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 20939269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 101 - 219
Target Start/End: Original strand, 26813863 - 26813980
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||             |||||||||||| ||||||||| |||||    
26813863 attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaaaaaaaaattgtttttggtctctgcaaaattttttg 26813961  T
201 tttttggaaatagtccctg 219  Q
    |||||| ||||||||||||    
26813962 tttttgaaaatagtccctg 26813980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 205
Target Start/End: Complemental strand, 29182440 - 29182342
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||| || |||||||||||||| ||||||||||||||  ||||         |||||||||||||||||||||||||||||| |||||    
29182440 ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtttctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttattttt 29182342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 33576117 - 33576062
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
33576117 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 33576062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 41451837 - 41451892
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
41451837 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 41451892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 192
Target Start/End: Complemental strand, 44559407 - 44559321
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||| |||||||| |||||||||||||| ||||||||||||||| ||||         |||||||||||||||||||||||    
44559407 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaaaattcttttgttgtttttggtccctgcaaa 44559321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 103 - 192
Target Start/End: Complemental strand, 5335041 - 5334952
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
5335041 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 5334952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 101 - 159
Target Start/End: Complemental strand, 5790902 - 5790844
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||    
5790902 attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 5790844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 23989838 - 23989950
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| || ||||||||||||||| || |         ||||   |||||||||||||||||| ||||||||    
23989838 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcactataaaaaaaaattgt---ttttggtccctgcaaaattttttgttt 23989934  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
23989935 ttgaaaatagtccctg 23989950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 4794130 - 4794218
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||| || |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
4794130 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaacaaaaatttgttgtttttggtccctgcaaa 4794218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 10671630 - 10671718
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||| ||| ||||||||||||||||||||         || ||||||||||||||||||||    
10671630 ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaa 10671718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 16673411 - 16673499
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||||||  ||||||||||||||||||          |||||||||||||||||||||||    
16673411 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgcaagaaaattttgttgtttttggtccctgcaaa 16673499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 17912452 - 17912563
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||||| ||| |||||||||||||| ||||||||||||||| |||             |||||||||||||||||||||| |||||||||||    
17912452 taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgtttttg 17912550  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
17912551 aaaatagtccctg 17912563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 23732328 - 23732241
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||||||||||||||| || ||||||| ||||||||||||         |||||||||||||||||||||||    
23732328 ggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa 23732241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 24483891 - 24483780
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            || ||||||||||||||||||| ||||||||    
24483891 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttatttttggtccctgcaaaattttttgttt 24483795  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
24483794 ttgaaaatagtccct 24483780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 25705449 - 25705361
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
25705449 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 25705361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 36815835 - 36815747
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||||||  ||||||||||||| |||||||||||||| |||||         |||||||||||||||||||||||    
36815835 ggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaa 36815747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 2265397 - 2265341
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||| |||  ||||||||||||| ||||||||||||||||||||    
2265397 ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgt 2265341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 10375070 - 10374959
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| |||||||||||||| |||||||||||| |||||||             ||||||||||||||||||||| | |||||    
10375070 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaa-----tgtttttggtccctgcaaaatttgttgtt 10374976  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
10374975 tttgaaaatagtccctg 10374959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 10665294 - 10665179
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  |||| |||||||||||||||  | |||||||||||||| |||||          | ||||||||||||||| |||||| ||||||||    
10665294 ggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctacaaaattttttgttt 10665195  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
10665194 ttgaaaatagtccctg 10665179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 16522991 - 16523047
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||    
16522991 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 16523047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 17302143 - 17302087
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||  |||||||||||||| ||||||||||||||||||||    
17302143 ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt 17302087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 217
Target Start/End: Original strand, 22881613 - 22881723
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||| |||         ||||   |||||||||||||||||| ||||||||    
22881613 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaattgt---ttttggtccctgcaaaattttttgttt 22881709  T
204 ttggaaatagtccc 217  Q
    ||| ||||||||||    
22881710 ttgaaaatagtccc 22881723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 26814229 - 26814114
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||| ||||||||||||| ||||||||    
26814229 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgttttttgtccctgcaaaattttttgttt 26814130  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
26814129 ttgaaaatagtccctg 26814114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 170 - 218
Target Start/End: Complemental strand, 29832088 - 29832040
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||||||||||||||||||  |||||||||||    
29832088 ttgttgtttttggtccctgcaaaatattttgttttttaaaatagtccct 29832040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 34964163 - 34964103
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||| |||||||| |||||||||||||| ||||| ||||||| ||||||    
34964163 aattggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgt 34964103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 35155619 - 35155563
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||| ||||||||||||||||| |||||||||||||    
35155619 ggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgt 35155563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 36622250 - 36622306
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
36622250 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 36622306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 38639412 - 38639524
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||| |||           |  ||||||||||||||||||||| ||||||||    
38639412 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaat--tgtttttggtccctgcaaaattttttgttt 38639509  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
38639510 ttgaaaatagtccct 38639524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 38980253 - 38980139
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
38980253 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 38980155  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
38980154 ttgaaaatagtccctg 38980139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 218
Target Start/End: Original strand, 43788853 - 43788972
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||| ||||||||||| || |||||||||||||||| ||             |||||||||||||||||||||| |||    
43788853 aaataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaaaaaaaaaatttgtttttggtccctgcaaaatgttt 43788952  T
199 tgtttttggaaatagtccct 218  Q
    |||||||| |||||||||||    
43788953 tgtttttgaaaatagtccct 43788972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 44073807 - 44073692
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||| ||||||||||||             |||||||||||||||||||||| ||||||||    
44073807 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 44073708  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
44073707 ttgaaaatagtccctg 44073692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 106 - 192
Target Start/End: Original strand, 146328 - 146414
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
146328 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa 146414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 146536 - 146575
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
146536 ggtccctgcaaaatattttgtttttggaaatagtccctgc 146575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 111 - 214
Target Start/End: Original strand, 1295190 - 1295292
Alignment:
111 atatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttggaaa 210  Q
    ||||||||||||||  || |||||||||| |||||||||||||||  |||         ||||||||||||||||||||||||||| ||||||||| |||    
1295190 atatgattttggtccatgtaaatatgtctcgttttggttttagtctttgtatattttt-ttgttgtttttggtccctgcaaaatatattgtttttgaaaa 1295288  T
211 tagt 214  Q
    ||||    
1295289 tagt 1295292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 106 - 216
Target Start/End: Complemental strand, 1497943 - 1497833
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| ||||  ||  |||||||||| || |||||||||||||||||||          || |||||||||||||||||||||| ||||||||||    
1497943 ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctgcagaactttttttttgtttttggtccctgcaaaattttttgttttt 1497844  T
206 ggaaatagtcc 216  Q
    | |||||||||    
1497843 gaaaatagtcc 1497833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 2481403 - 2481442
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
2481403 ggtccctgcaaaatattttgtttttggaaatagtccctgc 2481442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 101 - 156
Target Start/End: Complemental strand, 4042893 - 4042838
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||||| ||| |||| |||||||||||||| ||||||||||||||||    
4042893 attggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc 4042838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 16673621 - 16673660
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
16673621 ggtccctgcaaaatattttgtttttggaaatagtccctgc 16673660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 20131527 - 20131566
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
20131527 ggtccctgcaaaatattttgtttttggaaatagtccctgc 20131566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 218
Target Start/End: Complemental strand, 22881946 - 22881857
Alignment:
126 ctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||||||||||||         |||||   ||||||||||||||||| ||||||||||| |||||||||||    
22881946 ctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtt---tttggtccctgcaaaattttttgtttttgaaaatagtccct 22881857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 25705239 - 25705200
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
25705239 ggtccctgcaaaatattttgtttttggaaatagtccctgc 25705200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 29859485 - 29859575
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||| ||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
29859485 ttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 29859575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 29859697 - 29859736
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
29859697 ggtccctgcaaaatattttgtttttggaaatagtccctgc 29859736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 29865222 - 29865277
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||    
29865222 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 29865277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 30215716 - 30215755
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
30215716 ggtccctgcaaaatattttgtttttggaaatagtccctgc 30215755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 35685972 - 35686086
Alignment:
104 ggctaaaatatgatttt-ggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||||||| |||  |||||||||||  | ||||| ||||||||||||||         || |||||||| |||||||||||||||||||||    
35685972 ggctaaaatatgatttttggttcctgcaaatatggttcgttttagttttagtccctgtaaaaaaaa-ttattgtttttagtccctgcaaaatattttgtt 35686070  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
35686071 tttgaaaatagtccct 35686086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 37271739 - 37271853
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             ||||||||||||| |||||||| ||||||||    
37271739 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccttgcaaaattttttgttt 37271838  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
37271839 ttgaaaatagtccct 37271853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 206
Target Start/End: Complemental strand, 39367760 - 39367658
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| | ||| || ||| |||||||  || |||||||||||||| ||||         ||||||||||||||||||||||||||||||||||    
39367760 ggctaaaatatggtcttgatccctgtaaatatgctttattttggttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 39367661  T
204 ttg 206  Q
    |||    
39367660 ttg 39367658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 40124964 - 40125054
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| ||||||||||| ||  ||||||||||||| |||||         |||||||||||||||||||||||    
40124964 ttggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaa 40125054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 41452047 - 41452086
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
41452047 ggtccctgcaaaatattttgtttttggaaatagtccctgc 41452086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 44985984 - 44985870
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||  || |||||||||||||| ||||||||||||||||||||          | |||||||||||| ||||||||| ||||||||    
44985984 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaataaaattttgtttttggtctctgcaaaattttttgttt 44985885  T
204 ttggaaatagtccct 218  Q
    ||  || ||||||||    
44985884 tttaaattagtccct 44985870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 3671070 - 3671116
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
3671070 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 3671116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 215
Target Start/End: Complemental strand, 3832634 - 3832525
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnntt-gttgtttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||| |||||||| |||||||||||| | |||||||||||||||  |||         || |||||||||| ||||||||||||||| |||||||    
3832634 taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtctatgtaaatttttttttgttgtttttgatccctgcaaaatattatgttttt 3832535  T
206 ggaaatagtc 215  Q
    | ||||||||    
3832534 gaaaatagtc 3832525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 5163953 - 5164062
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||||||||| ||    ||||| ||||||||||||||||||||         || |||||||| |||| |||||||||||||||||    
5163953 ggctaaaatatggttttggtctctaca----tgtctcgttttggttttagtccctgtaatttttgttt-ttgttttttgtccttgcaaaatattttgttt 5164047  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
5164048 ttgaaaatagtccct 5164062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 7814737 - 7814629
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| ||  |||||||||||||||||||            |||||||||||||| ||||||| ||||||||    
7814737 ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtcaaaaaaaa---ttgtttttggtccccgcaaaattttttgttt 7814641  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
7814640 ttgaaaatagtc 7814629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 11788050 - 11788108
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||| ||| |||||||||| |||||| ||||| ||||||||||||||    
11788050 ttggctaaaatatgatgttgatctctgcaaaaatgtctcgttttcgttttagtccctgt 11788108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 182 - 220
Target Start/End: Original strand, 14003589 - 14003627
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||||||||||||||||    
14003589 gtccctgcaaaatattttgtttttggaaatagtccctgc 14003627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 15842464 - 15842549
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
15842464 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 15842549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 20658061 - 20658173
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||| ||| |||| ||| ||||||||||| |||||||||||||||||||||||            |||||||| ||||||||||||| ||||||||    
20658061 ggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaaaaaa---ttgtttttagtccctgcaaaattttttgttt 20658157  T
204 ttggaaatagtccctg 219  Q
    ||| ||||| ||||||    
20658158 ttgaaaataatccctg 20658173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 100 - 158
Target Start/End: Original strand, 27109069 - 27109127
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||||||| |||||||| || |||||||| || ||||||||||||||||||    
27109069 aattggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct 27109127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 33732862 - 33732973
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            ||||||||| |||||||||||| ||||||||    
33732862 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttgatccctgcaaaattttttgttt 33732957  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||| ||||    
33732958 ttgaaaatagttcctg 33732973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 38231429 - 38231487
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||||||| || ||||||||||  ||||||||| |||||||||||||    
38231429 ttggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgt 38231487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 38731829 - 38731941
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  |||| ||| ||||||||||| || ||||||||||||||||||||         ||||   |||||||||||||||||| ||||||||    
38731829 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgt---ttttggtccctgcaaaattttttgttt 38731925  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
38731926 tttaaaatagtccctg 38731941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 43597154 - 43597264
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||  ||||||||||| || ||||||||||||||||||||         |    |||||||||||||||||||| ||||||||    
43597154 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaat----gtttttggtccctgcaaaattttttgttt 43597249  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
43597250 ttgaaaatagtccct 43597264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 43789123 - 43789077
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
43789123 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 43789077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 219
Target Start/End: Original strand, 44985623 - 44985735
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | ||||||||||||| |||||||  ||||||||||    
44985623 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaagaat-ttgtttttggtccatgcaaaaatttttgttttt 44985721  T
206 ggaaatagtccctg 219  Q
    | ||||||||||||    
44985722 gaaaatagtccctg 44985735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 1497608 - 1497723
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| |||  |||||||||| || |||||| |||||||||||||          | ||||||||||||| |||||||| ||||||    
1497608 ttggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaaat-ttgtttttggtccttgcaaaattttttgt 1497706  T
202 ttttggaaatagtccct 218  Q
    ||||| |||||||||||    
1497707 ttttgaaaatagtccct 1497723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 2481193 - 2481281
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||   ||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
2481193 ggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 2481281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 198
Target Start/End: Complemental strand, 4794468 - 4794380
Alignment:
109 aaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    ||||||| |||||||| || ||||||||||| ||||||||||||||| ||||         |||||||||||||||||||||||||||||    
4794468 aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgt-aaaaaaaattgttgtttttggtccctgcaaaatattt 4794380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 207
Target Start/End: Complemental strand, 7121244 - 7121207
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttgg 207  Q
    ||||||||||||||||||||||||||||||||||||||    
7121244 ttgttgtttttggtccctgcaaaatattttgtttttgg 7121207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 103
Target Start/End: Original strand, 8267404 - 8267500
Alignment:
4 ttataagtatattactatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    ||||||||||||||   ||||| |||||||||  || |||||||||| | |||||| ||   ||||| || |||||||||||||||||||||||||||||    
8267404 ttataagtatatta---tatgagagataaattccagacatttgcatagcttaactgattaccaaaaatgcatcaattactcttggtcatgaattcaaatt 8267500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 9195053 - 9195110
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||    
9195053 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 9195110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 10671946 - 10671889
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||| |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
10671946 aaataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 10671889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 13850517 - 13850578
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| |||||||||||  ||||| ||||||||||||||||| | ||||||||||||||||||    
13850517 aaataggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgt 13850578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 14003409 - 14003497
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
14003409 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 14003497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 14392854 - 14392899
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||    
14392854 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccct 14392899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 14393128 - 14393016
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||||||| | || |||||||||||||| |||||||||||||||| |||          |  ||||||| ||||||||||||| ||||||||    
14393128 ggctaaaatatgatttagttc-ctgcaaatatgtctcgttttggttttagtccatgtaaaaaaaaaat--tgttttttgtccctgcaaaattttttgttt 14393032  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
14393031 ttgaaaatagtccctg 14393016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 17541450 - 17541495
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||    
17541450 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccct 17541495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 20658337 - 20658292
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||    
20658337 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccct 20658292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 24358945 - 24358857
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||| || ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
24358945 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 24358857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 29865511 - 29865402
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  ||||||||||  | ||||||||||||||||||||         ||  ||||||||||||||||||||| ||||||||    
29865511 ggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaaaataaaatt--tgtttttggtccctgcaaaattttttgttt 29865414  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
29865413 ttgaaaatagtc 29865402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 30215422 - 30215510
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
30215422 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 30215510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 37272102 - 37271991
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
37272102 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 37272004  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
37272003 ttgaaaatagtcc 37271991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 219
Target Start/End: Original strand, 43710448 - 43710493
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||||| ||||||||||| ||||||||||||    
43710448 tgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 43710493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 3172020 - 3172072
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||||||||||| ||||||||||| ||  |||||||||||||||    
3172020 ggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc 3172072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 218
Target Start/End: Complemental strand, 25954423 - 25954313
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| |||  |||||||||| || |||||| |||||||||||||          | |||||||||||||||||||||| |||||||||||    
25954423 taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaaataaaaattttgtttttggtccctgcaaaat-ttttgtttttg 25954325  T
207 gaaatagtccct 218  Q
     |||||||||||    
25954324 aaaatagtccct 25954313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 31226077 - 31225962
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||  || ||||||||||| || |||||||||||| |||||||            |||||||| ||||||||||||| ||||||||    
31226077 ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgtaaaaaaaaaaaattgttttttgtccctgcaaaattttttgttt 31225978  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
31225977 ttgaaaatagtccctg 31225962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 31326252 - 31326141
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  |||| |||  |||||||||| || ||||| ||||||||||||||         || |||||||||||||||||||||| ||||||||    
31326252 ggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaaaataaaatttttgtttttggtccctgcaaaattttttgttt 31326153  T
204 ttggaaatagtc 215  Q
    ||  ||||||||    
31326152 tttaaaatagtc 31326141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 37228733 - 37228789
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||| | ||||||||||||||| ||||    
37228733 ggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgt 37228789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 218
Target Start/End: Complemental strand, 38231818 - 38231707
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||||||||| || || ||||||||  | |||||| ||||||||| |||         ||||||||||| |||| || |||||||||||||||||    
38231818 taaaatatgattttgatccctccaaatatgcttcgttttgattttagtccatgtaaatcttttttgttgtttttagtccgtgtaaaatattttgtttttg 38231719  T
207 gaaatagtccct 218  Q
     |||||||||||    
38231718 aaaatagtccct 38231707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #136
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 40786460 - 40786516
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||  || |||||||||||||| ||||||||||||||||||||    
40786460 ggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgt 40786516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #137
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 41693674 - 41693730
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||| | ||||||||||||||||||||    
41693674 ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 41693730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #138
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 206
Target Start/End: Original strand, 42358702 - 42358801
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | ||| |||||||||||||||||| |||||||||||    
42358702 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgattttggtccctgcaaaattttttgtttttg 42358801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #139
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 45442696 - 45442644
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||||||| |||  ||||||||||||| ||||||||||||||||    
45442696 ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc 45442644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 3671195 - 3671136
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||| ||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
3671195 attggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 3671136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 194
Target Start/End: Original strand, 4042610 - 4042699
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||| ||||| || ||||||||||| || |||||||||||||| |||||         |||||||||||||||||||||||||    
4042610 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt-cctgtaaattttttttgttgtttttggtccctgcaaaat 4042699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 5006610 - 5006657
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    ||||||||| ||||||||||||||||||| ||| ||||||||||||||    
5006610 taaaatatggttttggtctctgcaaatatatctcgttttggttttagt 5006657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 217
Target Start/End: Complemental strand, 13850816 - 13850769
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    ||||||||||||||||||||||| ||||||||||||  ||||||||||    
13850816 ttgttgtttttggtccctgcaaagtattttgtttttaaaaatagtccc 13850769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 16900206 - 16900151
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
16900206 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 16900151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #145
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 16993597 - 16993542
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
16993597 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 16993542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 19184151 - 19184096
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
19184151 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 19184096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #147
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 26238816 - 26238925
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| ||| |||||||||||||| |||||| |||||||||||||            |||| ||||||||||||||| | |||||||||||    
26238816 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaa---ttgtgtttggtccctgcaaatttttttgtttttg 26238912  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
26238913 aaaatagtccctg 26238925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #148
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 26239160 - 26239105
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| ||||||||||||    
26239160 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 26239105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #149
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 218
Target Start/End: Complemental strand, 33733244 - 33733129
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||| ||||||||||| || |||||||||||| ||||| |          |  ||||||||||||||||||||  |||||    
33733244 attggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctataaaaaaaaaat--tgtttttggtccctgcaaaaatttttg 33733147  T
201 tttttggaaatagtccct 218  Q
    |||||| |||||||||||    
33733146 tttttgaaaatagtccct 33733129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #150
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 34318090 - 34318031
Alignment:
97 tcaaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||||||||| |||||||| || |||||||| || |||||| |||||||||    
34318090 tcaaattggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc 34318031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #151
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 36815623 - 36815584
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||||| |||||||||||||    
36815623 ggtccctgcaaaatattttgtttttgaaaatagtccctgc 36815584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #152
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 1137983 - 1138037
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||||||| ||||||||||| || ||||||||||| ||||||||    
1137983 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgt 1138037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #153
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 17541708 - 17541662
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||  ||||||||||||    
17541708 ttgtttttggtccctgcaaaattttttgttttttaaaatagtccctg 17541662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #154
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 17912743 - 17912697
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||  ||||||||||||    
17912743 ttgtttttggtccctgcaaaattttttgttttttaaaatagtccctg 17912697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #155
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 25299747 - 25299801
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||||| ||||||||||| || |||||  |||||||||||||    
25299747 ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgt 25299801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #156
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 26707939 - 26707985
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| | ||||||||| ||||||||||||    
26707939 ttgtttttggtccctgcaaaatttgttgtttttgaaaatagtccctg 26707985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #157
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 27109253 - 27109291
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||| ||||||||||||    
27109253 ggtccctgcaaaatattttgtttttgaaaatagtccctg 27109291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #158
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 21 - 103
Target Start/End: Original strand, 36076399 - 36076481
Alignment:
21 tatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    ||||||||||||| || || |||||||||||| |||||| || | || || || ||| |||||||||||| ||||||||||||    
36076399 tatgatagataaactacagacatttgcataacttaactgattatcaagaaggcctcagttactcttggtcttgaattcaaatt 36076481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #159
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 41791086 - 41791132
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||| ||||||||| ||||||||||| ||||||||||||    
41791086 ttgtttttggtctctgcaaaattttttgtttttgaaaatagtccctg 41791132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #160
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 158
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    ||||||||||| ||||||   |||||||||||||| ||||||||||||||||||    
4842865 gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct 4842918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #161
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 8046649 - 8046592
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| |||| ||| || |||||||| || ||||||||||||||||||||    
8046649 tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 8046592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #162
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 10664984 - 10665093
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| | |||||||||||            ||||||||||||| |||||||| ||||||||    
10664984 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaaaaaaaaa--attgtttttggtccttgcaaaattttttgttt 10665081  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
10665082 ttgaaaatagtc 10665093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #163
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 16968555 - 16968608
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||| ||| || |||||||| |||||||||||||||||||||||    
16968555 taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgt 16968608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #164
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 19184083 - 19184042
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||| ||||||||||| |||||||    
19184083 ttgtttttggtccctgcaaaattttttgtttttgaaaatagt 19184042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #165
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 207
Target Start/End: Complemental strand, 27109337 - 27109300
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttgg 207  Q
    ||||||||||| ||||||||||||||||||||||||||    
27109337 ttgttgtttttagtccctgcaaaatattttgtttttgg 27109300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #166
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 29182168 - 29182256
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||||||||||  ||||||||||| |  |||||||||||||| ||||         |||||||||||||||| ||||||    
29182168 ggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctgtaatttctttttgttgtttttggtccatgcaaa 29182256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #167
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 31909478 - 31909391
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| | | |||||||||||||| ||||         |||||||||||||||||||||||    
31909478 ggctaaaatatggttttggtccctgcaaatatg-cctcttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaa 31909391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #168
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 218
Target Start/End: Original strand, 34963796 - 34963911
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnt--tgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||| ||||| || |||| ||||||| |||||||| |||||||| ||||         |  |||||||||| ||| ||||||||||||||||     
34963796 gctaaaatatggttttgatccctgctaatatgttttgttttgattttagtctctgtagttttttttgttgttgttttttgtctctgcaaaatattttgta 34963895  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
34963896 tttgaaaatagtccct 34963911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #169
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 36622517 - 36622476
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||| ||||||||||| |||||||    
36622517 ttgtttttggtccctgcaaaattttttgtttttgaaaatagt 36622476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #170
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 37911120 - 37911032
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||  | |||||||||||| |||||||         |||||||||||||||| ||||||    
37911120 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgtaaaatttttttgttgtttttggtccatgcaaa 37911032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #171
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 43592046 - 43592159
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  |||||||||| || ||||||||||||||||||||            ||||||||||||| ||||||  |||||||||    
43592046 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaataatttgtttttggtccttgcaaa--attttgttt 43592143  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
43592144 ttgaaaatagtccctg 43592159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #172
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 3837933 - 3837989
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||  |||| ||| |||||||||||||| ||||| ||||||||||||||    
3837933 ggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgt 3837989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #173
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 5790557 - 5790613
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||| | || ||| ||||||||||| || |||||||||||||||||||    
5790557 tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg 5790613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #174
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 8046329 - 8046385
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||  || ||||||||||| || ||||||||||||||||||||    
8046329 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt 8046385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #175
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 9195206 - 9195150
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| | | ||||||||||| || ||||||||||||||||||||    
9195206 ggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgt 9195150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #176
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 17541776 - 17541724
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| ||||  || |||||||||||||| ||||||||||||||||    
17541776 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc 17541724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 18113303 - 18113339
Alignment:
184 ccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||| |||||||||||||    
18113303 ccctgcaaaatattttgtttttgaaaatagtccctgc 18113339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 25954115 - 25954167
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||| | ||||||||||||||||    
25954115 ggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc 25954167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #179
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 32691313 - 32691369
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| || |||||||||||| || |||||||||||| |||||||    
32691313 ggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgt 32691369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #180
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 158
Target Start/End: Original strand, 43710379 - 43710435
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||| |||||||| ||||| ||| || ||||||||||| ||||||||||||||||||    
43710379 ttggttaaaatataattttagtcccttcaaatatgtctcgttttggttttagtccct 43710435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #181
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 43710708 - 43710652
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||| | |  |||||||||| || ||||||||||||||||||||    
43710708 ggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgt 43710652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #182
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 45442316 - 45442364
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||||| |||| |||||||||||||||||| |||||| |||||    
45442316 ggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta 45442364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 3838096 - 3838061
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
3838096 ttgtagtttttggtccctgcaaaatattttgttttt 3838061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 4731879 - 4731844
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
4731879 ttgtagtttttggtccctgcaaaatattttgttttt 4731844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 217
Target Start/End: Original strand, 4794342 - 4794377
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    ||||||| ||||||||||||||||||||||||||||    
4794342 gtccctgtaaaatattttgtttttggaaatagtccc 4794377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 8046496 - 8046531
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
8046496 ttgtagtttttggtccctgcaaaatattttgttttt 8046531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 10374775 - 10374830
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||| ||| ||||||||||| || |||||||||||||| |||||    
10374775 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 10374830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #188
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 10374910 - 10374875
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
10374910 ttgtagtttttggtccctgcaaaatattttgttttt 10374875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #189
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 12414033 - 12413998
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
12414033 ttgtagtttttggtccctgcaaaatattttgttttt 12413998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #190
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 12426093 - 12426058
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
12426093 ttgtagtttttggtccctgcaaaatattttgttttt 12426058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #191
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 151
Target Start/End: Complemental strand, 13215365 - 13215318
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    ||||||||||||  ||||||| |||||||||||||| |||||||||||    
13215365 ggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt 13215318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #192
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 17541382 - 17541437
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| | ||||||||| || |||||||||||||||||||    
17541382 ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg 17541437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #193
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 19183950 - 19183985
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
19183950 ttgtagtttttggtccctgcaaaatattttgttttt 19183985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #194
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 19831628 - 19831593
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
19831628 ttgtagtttttggtccctgcaaaatattttgttttt 19831593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #195
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 22881803 - 22881768
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
22881803 ttgtagtttttggtccctgcaaaatattttgttttt 22881768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #196
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 23990003 - 23990038
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
23990003 ttgtagtttttggtccctgcaaaatattttgttttt 23990038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #197
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 24483565 - 24483600
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
24483565 ttgtagtttttggtccctgcaaaatattttgttttt 24483600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #198
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 26709696 - 26709747
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||||||||||| ||  |||||||||||||| |||||||| ||||||    
26709696 ggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc 26709747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #199
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 26814061 - 26814026
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
26814061 ttgtagtttttggtccctgcaaaatattttgttttt 26814026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #200
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 32691479 - 32691514
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
32691479 ttgtagtttttggtccctgcaaaatattttgttttt 32691514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #201
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 32691521 - 32691560
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||| ||||||||||| |||||||||||||    
32691521 ggtccctgcaaaattttttgtttttgaaaatagtccctgc 32691560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #202
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 110 - 192
Target Start/End: Original strand, 35155298 - 35155380
Alignment:
110 aatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||| |||| ||| |||||||||||||| |||||||||||||||| ||          |||||||||||||||||||||||    
35155298 aatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgcaaaaaaaaattgttgtttttggtccctgcaaa 35155380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #203
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 37228975 - 37228932
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||| ||||||||||||||||||||||||  |||||||||    
37228975 ttgttttttgtccctgcaaaatattttgttttttaaaatagtcc 37228932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #204
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 37910909 - 37910870
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||| ||||||||||| |||||||||||||    
37910909 ggtccctgcaaaatgttttgtttttgaaaatagtccctgc 37910870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #205
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 38980086 - 38980051
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
38980086 ttgtagtttttggtccctgcaaaatattttgttttt 38980051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #206
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 201
Target Start/End: Complemental strand, 39367650 - 39367619
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||||||||||||||||||||||    
39367650 ttgttgtttttggtccctgcaaaatattttgt 39367619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #207
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 40302143 - 40302178
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
40302143 ttgtagtttttggtccctgcaaaatattttgttttt 40302178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #208
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 40786627 - 40786662
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
40786627 ttgtagtttttggtccctgcaaaatattttgttttt 40786662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #209
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 43710546 - 43710581
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
43710546 ttgtagtttttggtccctgcaaaatattttgttttt 43710581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #210
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 44985788 - 44985823
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
44985788 ttgtagtttttggtccctgcaaaatattttgttttt 44985823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #211
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 45442480 - 45442515
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
45442480 ttgtagtttttggtccctgcaaaatattttgttttt 45442515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #212
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 1295549 - 1295491
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| ||||||||| ||||| |  |||||||||||| | ||||||||||||||||||||    
1295549 ttggttaaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgt 1295491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #213
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 1497772 - 1497742
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
1497772 gtttttggtccctgcaaaatattttgttttt 1497742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #214
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 5790728 - 5790698
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
5790728 gtttttggtccctgcaaaatattttgttttt 5790698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 7814397 - 7814359
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
7814397 ggtccctgcaaaattttttgtttttgaaaatagtccctg 7814359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 220
Target Start/End: Complemental strand, 14392963 - 14392913
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||| |||||||||| ||||||||||||||||||||  ||| |||||||||    
14392963 ttgtagtttttggtctctgcaaaatattttgtttttaaaaaaagtccctgc 14392913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 22881761 - 22881723
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
22881761 ggtccctgcaaaattttttgtttttgaaaatagtccctg 22881723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #218
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 24483466 - 24483508
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||  ||||||||    
24483466 ttgtttttggtccctgcaaaattttttgtttttaaaaatagtc 24483508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #219
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 24483607 - 24483645
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
24483607 ggtccctgcaaaattttttgtttttgaaaatagtccctg 24483645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #220
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 27311069 - 27311015
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| |||  |||||||||| || ||||||||||||||||||    
27311069 ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct 27311015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #221
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 29865340 - 29865310
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
29865340 gtttttggtccctgcaaaatattttgttttt 29865310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #222
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 219
Target Start/End: Original strand, 33575869 - 33575899
Alignment:
189 caaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||||||||    
33575869 caaaatattttgtttttggaaatagtccctg 33575899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #223
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 38639564 - 38639526
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
38639564 ggtccctgcaaaattttttgtttttgaaaatagtccctg 38639526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #224
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 40302185 - 40302223
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
40302185 ggtccctgcaaaatgttttgtttttgaaaatagtccctg 40302223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #225
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 215
Target Start/End: Original strand, 43672143 - 43672177
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||||||| ||||||||    
43672143 ggtccctgcaaaatattttgtttttgaaaatagtc 43672177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #226
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 44073634 - 44073604
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
44073634 gtttttggtccctgcaaaatattttgttttt 44073604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #227
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 215
Target Start/End: Complemental strand, 44559198 - 44559164
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||||||| ||||||||    
44559198 ggtccctgcaaaatattttgtttttgaaaatagtc 44559164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #228
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 17541567 - 17541530
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
17541567 ggtccctgcaaaattttttgtttttgaaaatagtccct 17541530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #229
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 19831511 - 19831564
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||| |||| ||||||||||| | |||||||||||||| |||||    
19831511 taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt 19831564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #230
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 35155503 - 35155536
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||||||| |||||||    
35155503 ggtccctgcaaaatattttgtttttgaaaatagt 35155536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #231
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 38979888 - 38979945
Alignment:
103 tggctaaaatatgattttggtctctgcaaatat-gtcttgttttggttttagtccctg 159  Q
    ||||||||||||| |||| ||| ||||||||||  ||| |||||||||||||||||||    
38979888 tggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg 38979945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #232
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 38979959 - 38980004
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||| |||||||| | ||||||||||| |||||||||||    
38979959 ttgtttttggtacctgcaaatttttttgtttttgaaaatagtccct 38980004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #233
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Original strand, 1138055 - 1138095
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||| |||||||||||||| ||||||||||| |||||    
1138055 ttttggtccctgcaaatatgtctcgttttggttttggtccc 1138095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #234
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 3671003 - 3671059
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||  |||||||||| || |||||| |||||||||||||    
3671003 ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt 3671059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #235
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 5790831 - 5790787
Alignment:
173 ttgtttttggtccctgc-aaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||| |||| |||||||||||| |||||||||    
5790831 ttgtttttggtccctgcaaaaaaattttgtttttgaaaatagtcc 5790787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #236
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 15842671 - 15842708
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||  |||||||||||||||||||||    
15842671 ggtccctgcaaaatatt--gtttttggaaatagtccctgc 15842708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #237
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||| |||| |||  ||||||||||||| |||||||||||||||    
23990193 taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 23990145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #238
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 154
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||| |||||||| |||||||||||| || |||||||||||||    
25300038 ctaaaatatggttttggtccctgcaaatatgt-ttcttttggttttagt 25299991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #239
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 26709766 - 26709806
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||| | ||||||||||| |||||||||    
26709766 tttttggtccctgcaaattcttttgtttttgaaaatagtcc 26709806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #240
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 27310876 - 27310931
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||| ||||||||||||    
27310876 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgt 27310931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #241
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 217
Target Start/End: Complemental strand, 33575927 - 33575899
Alignment:
189 caaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||||||||||    
33575927 caaaatattttgtttttggaaatagtccc 33575899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #242
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 37606002 - 37605918
Alignment:
19 tatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    ||||||| |||||||||| |  |||||||||| | |||||| ||   |||||  |||||||||||||| |||||||| |||||||    
37606002 tatatgacagataaattacaagcatttgcatagcttaactgattaccaaaaagacttcaattactcttagtcatgaactcaaatt 37605918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #243
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 43592380 - 43592328
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||||||| ||| |||| |||||||||  ||||| |||||||||    
43592380 ggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtcc 43592328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #244
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 44994061 - 44994005
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||  || |||||||||||||| ||||| ||||||||| ||||    
44994061 ggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgt 44994005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 310)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 101 - 220
Target Start/End: Original strand, 9261786 - 9261905
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||||||    
9261786 attggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttggtccctgcaaaatattttg 9261885  T
201 tttttggaaatagtccctgc 220  Q
    |||||| |||||||||||||    
9261886 tttttgaaaatagtccctgc 9261905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 47336581 - 47336466
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
47336581 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 47336482  T
204 ttggaaatagtccctg 219  Q
    ||||||||||||||||    
47336481 ttggaaatagtccctg 47336466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 51550446 - 51550330
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||| ||    
51550446 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttggtccctgcaaaatattttgctt 51550347  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
51550346 ttggaaatagtccctgc 51550330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 103 - 218
Target Start/End: Complemental strand, 26090079 - 26089964
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||| |||||||||||||    
26090079 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgtaaaatattttgtt 26089980  T
203 tttggaaatagtccct 218  Q
    ||||||||||||||||    
26089979 tttggaaatagtccct 26089964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 28452147 - 28452261
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||||||  |||||||||||||||||||||||||||||| |||         ||||||||||||||||||||||||||||||||||    
28452147 ggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 28452246  T
204 ttggaaatagtccct 218  Q
    |||||||||||||||    
28452247 ttggaaatagtccct 28452261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 474044 - 474160
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||| ||||||||||||||||||||||||||||||    
474044 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttggtgtttttggtccctgcaaaatattttgttt 474143  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
474144 ttggaaatagtccctgc 474160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 45002385 - 45002269
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||||||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | |||    
45002385 ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattttt 45002286  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
45002285 ttggaaatagtccctgc 45002269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 15979701 - 15979586
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| || ||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
15979701 ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaa-ttgttgtttttggtccctgcaaaatattttgttt 15979603  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
15979602 ttggaaatagtccctgc 15979586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 104 - 217
Target Start/End: Original strand, 28552021 - 28552134
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||| ||||||||||||||         ||||||||||||||||||||||||||||||||||    
28552021 ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 28552120  T
204 ttggaaatagtccc 217  Q
    ||||||||||||||    
28552121 ttggaaatagtccc 28552134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 103 - 220
Target Start/End: Original strand, 49323781 - 49323898
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | ||    
49323781 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattatttt 49323880  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
49323881 tttggaaatagtccctgc 49323898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 12741271 - 12741159
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||||||||||| | |||    
12741271 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattttt 12741172  T
204 ttggaaatagtcc 216  Q
    |||||||||||||    
12741171 ttggaaatagtcc 12741159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 22008526 - 22008642
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||| ||||||||||||| |||    
22008526 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatatttttttt 22008625  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
22008626 ttggaaatagtccctgc 22008642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 22016044 - 22016160
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||| ||||||||||||| |||    
22016044 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatatttttttt 22016143  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
22016144 ttggaaatagtccctgc 22016160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 31480136 - 31480252
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | |||    
31480136 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattttt 31480235  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
31480236 ttggaaatagtccctgc 31480252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 32119220 - 32119336
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  |||||||| |||||||||||||| ||||| |||||||||||||          ||||||||||||||||||||||||||||||||||    
32119220 ggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgttt 32119319  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
32119320 ttggaaatagtccctgc 32119336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 107 - 219
Target Start/End: Complemental strand, 35569133 - 35569021
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||| ||||||||||||||||||||    
35569133 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttgtttttg 35569034  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
35569033 aaaatagtccctg 35569021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 43441603 - 43441487
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
43441603 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 43441504  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
43441503 ttggaaatagtccctgc 43441487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 107 - 218
Target Start/End: Complemental strand, 4322186 - 4322075
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||  |||||||| |||||||||||||||||||||||||||||||||||         |||||||||||||| ||||||||||||||||||||||    
4322186 taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaatttcttttgttgtttttggttcctgcaaaatattttgtttttg 4322087  T
207 gaaatagtccct 218  Q
     |||||||||||    
4322086 aaaatagtccct 4322075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 863281 - 863395
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||||||||||||  ||||||||||||| ||||| ||||||||| ||||         ||||||||||||||||||||||||||||||||||    
863281 ggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 863380  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
863381 ttgaaaatagtccct 863395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 103 - 220
Target Start/End: Original strand, 40370284 - 40370401
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||||||| |||||||||||||| ||||| |||||||| |||||         ||||||||||||||||||||||||||| || ||    
40370284 tggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatatcttatt 40370383  T
203 tttggaaatagtccctgc 220  Q
    |||| |||||||||||||    
40370384 tttgaaaatagtccctgc 40370401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 104 - 203
Target Start/End: Complemental strand, 54608863 - 54608764
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
54608863 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 54608764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 106 - 220
Target Start/End: Complemental strand, 45006247 - 45006133
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||  |||| ||| ||||||||||| || |||||||||||| |||||||         ||||||||||||||||||||||||||||||||||||    
45006247 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttttt 45006148  T
206 ggaaatagtccctgc 220  Q
    |||||||||||||||    
45006147 ggaaatagtccctgc 45006133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 27681682 - 27681570
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| || ||||||||||||||||| || |||||||||||| |||||||         |||||||||||| |||||||||||||||||||||    
27681682 ggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgtaatatttttttgttgtttttgatccctgcaaaatattttgttt 27681583  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
27681582 ttgaaaatagtcc 27681570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 106 - 222
Target Start/End: Original strand, 30034109 - 30034225
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| ||||||||  || ||||||| || |||||||||||| ||| |||         ||||||||||||||||||||||||||||||||||||    
30034109 ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttttt 30034208  T
206 ggaaatagtccctgctg 222  Q
    |||||||||||||||||    
30034209 ggaaatagtccctgctg 30034225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 25609767 - 25609881
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||||||| | |||||| | || ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
25609767 ggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaaaaaaaa-ttgttgtttttggtccctgcaaaatattttgttt 25609865  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
25609866 ttgaaaatagtccctg 25609881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 38232241 - 38232354
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnn--ttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||||||||||| |||||||||||||| |||||| ||||||||| |||           ||||||||||||||||||||||||||||||||    
38232241 ggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttgtaaaaaaaaaatttgttgtttttggtccctgcaaaatattttgt 38232340  T
202 ttttggaaatagtc 215  Q
    ||||| ||||||||    
38232341 ttttgaaaatagtc 38232354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 47005519 - 47005405
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||  || |||||||||||||||| |||         ||||||||||||||||||||||||||||||||||    
47005519 ggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatattttgttt 47005420  T
204 ttggaaatagtccct 218  Q
    ||| |||||| ||||    
47005419 ttgaaaatagcccct 47005405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 105 - 219
Target Start/End: Complemental strand, 28418899 - 28418786
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||||||| |||||||||||| |||||||| |||||||||||||         ||||||||||||||| ||| |||||||||||||||    
28418899 gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgt-aatttttgttgttgtttttggtctctgtaaaatattttgtttt 28418801  T
205 tggaaatagtccctg 219  Q
    || ||||||||||||    
28418800 tgaaaatagtccctg 28418786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 99 - 208
Target Start/End: Complemental strand, 35407795 - 35407687
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| ||||| || |||||||||||||||||||| ||||||||||||||         |||||||||||| ||||||||||||||||    
35407795 aaataggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgt-aaaaaaatttgttgtttttgatccctgcaaaatattt 35407697  T
199 tgtttttgga 208  Q
    ||||||||||    
35407696 tgtttttgga 35407687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 45313864 - 45313748
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| |||||||||||  | |||||| |||||||||||||         || | |||||||||||||||||||||||||| |    
45313864 tggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaattttagtttttagtttttggtccctgcaaaatattttgat 45313765  T
203 tttggaaatagtccctg 219  Q
    |||||||||||||||||    
45313764 tttggaaatagtccctg 45313748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 1721452 - 1721338
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||  | ||||||||||||||||||||          |||||| ||||||||||||||||||||||||||    
1721452 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaaatttttgtgttgtatttggtccctgcaaaatattttgttt 1721353  T
204 ttggaaatagtccct 218  Q
    ||| ||||| |||||    
1721352 ttgaaaataatccct 1721338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 107 - 220
Target Start/End: Original strand, 8940163 - 8940277
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatt-ttgttttt 205  Q
    ||||||||| ||||| |||||||||||||  || ||||||||||||||||||||         ||||||||||||||||||||||||||||  | |||||    
8940163 taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattaattttttt 8940262  T
206 ggaaatagtccctgc 220  Q
    |||||||||||||||    
8940263 ggaaatagtccctgc 8940277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 30128284 - 30128393
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||| |||||| |||||||||||||| |||||         |||||||||||||||||||| |||||||||||||    
30128284 ggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgtaaaaaaa--ttgttgtttttggtccctgctaaatattttgttt 30128381  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
30128382 ttgaaaatagtc 30128393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 39436718 - 39436831
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||           | |||||||||||||||||||||||||||||||    
39436718 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaat-ttgtttttggtccctgcaaaatattttgttt 39436816  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
39436817 ttgaaaatagtccct 39436831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 103 - 192
Target Start/End: Original strand, 4034716 - 4034805
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||||||    
4034716 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 4034805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 36672966 - 36673051
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||         |||||||||||||||||||||||    
36672966 taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaa 36673051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 101 - 219
Target Start/End: Original strand, 15016385 - 15016500
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||| ||||||||||| |||||||||||||||||||||||            |||||||||||||||||||||| |||||    
15016385 attggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtgaaaaaaaa---ttgtttttggtccctgcaaaattttttg 15016481  T
201 tttttggaaatagtccctg 219  Q
    |||||  ||||||||||||    
15016482 ttttttaaaatagtccctg 15016500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 200
Target Start/End: Complemental strand, 19844581 - 19844485
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||||||||| |||||||| ||||||||||| ||  |||||||||||||||||||         |||||||||||||||||||||||||||||||    
19844581 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 19844485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 45320979 - 45320866
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||         |  ||||||||| |||||||||||| ||||||||    
45320979 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaat--ttgtttttgatccctgcaaaattttttgttt 45320882  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
45320881 ttgaaaatagtccctg 45320866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 212
Target Start/End: Original strand, 47114487 - 47114594
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||||||| |||||||||||||| ||||||||||||||| | |          |||||||||||| |||||||||||||||||||||    
47114487 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtcgc-ggcaattttttttgttgtttttgatccctgcaaaatattttgttt 47114585  T
204 ttggaaata 212  Q
    ||| |||||    
47114586 ttgaaaata 47114594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 52956381 - 52956497
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||  |||||||| || | ||||||||| |||||||||||||| | |||          |||||||||||||||||||||||||||||||    
52956381 ttggctaaaatatacttttggtccctactaatatgtctcgttttggttttagttcatgtaaaaaaaatgtgttgtttttggtccctgcaaaatattttgt 52956480  T
202 ttttggaaatagtccct 218  Q
    ||||| |||||||||||    
52956481 ttttgaaaatagtccct 52956497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 13584367 - 13584252
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| ||||||||||||||||||||||             |||||||||||||||||||||| ||||||||    
13584367 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 13584268  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
13584267 ttgaaaatagtccctg 13584252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 21159817 - 21159702
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||| |||||          | |||||||||||||||||||||| ||||||||    
21159817 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgttt 21159718  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
21159717 ttgaaaatagtccctg 21159702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 103 - 218
Target Start/End: Original strand, 29445953 - 29446068
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| |||||||    
29445953 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttggtccctgcaaaattttttgtt 29446052  T
203 tttggaaatagtccct 218  Q
    |||  |||||||||||    
29446053 ttttaaaatagtccct 29446068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 170 - 217
Target Start/End: Original strand, 20404958 - 20405005
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
20404958 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 20405005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 219
Target Start/End: Complemental strand, 40169656 - 40169539
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| |||||||||||||| |||||| ||||||||||||           | ||||||||||||||| |||||| ||||||    
40169656 ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaattttgtttttggtcccttcaaaattttttgt 40169557  T
202 ttttggaaatagtccctg 219  Q
    ||||| ||||||||||||    
40169556 ttttgaaaatagtccctg 40169539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 12740907 - 12740995
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
12740907 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 12740995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 29686544 - 29686632
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||| |||||| ||||||||  ||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||    
29686544 ggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaatatttttttgttgtttttggtccctgcaaa 29686632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 32119584 - 32119496
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
32119584 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 32119496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 106 - 214
Target Start/End: Original strand, 46724545 - 46724653
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||| ||  ||||||||| ||| ||||| ||||||||||||||         || ||||||||||||||||||||||||||| |||||    
46724545 ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaaatattttattttt 46724644  T
206 ggaaatagt 214  Q
    | |||||||    
46724645 gaaaatagt 46724653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 47005154 - 47005242
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||||         |||||||||||||||||||||||    
47005154 ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaatttttttttgttgtttttggtccctgcaaa 47005242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 52342195 - 52342310
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| ||  ||||||||||| || || |         |||||||||||||||| |||||||||||||||||    
52342195 ggctaaaatatggttttggtccctgcaaatatgcctccttttggttttaatctctataaaaaaaaattgttgtttttggtcc-tgcaaaatattttgttt 52342293  T
204 ttggaaatagtccctgc 220  Q
    ||| |||||||||||||    
52342294 ttgaaaatagtccctgc 52342310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 4950037 - 4950149
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||         |  ||||||||||||| |||||||| ||||||||    
4950037 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaat--ttgtttttggtccttgcaaaattttttgttt 4950134  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
4950135 ttgaaaatagtccct 4950149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 14633889 - 14633774
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct-gtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||| |||| |||| ||| ||||||||||||||||||||||||||||||||| ||            |||||||||||||||||||||| |||||||    
14633889 ggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggttaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt 14633790  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
14633789 tttgaaaatagtccct 14633774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 22155929 - 22156044
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| ||||||||||||             |||||||||||||||||||||| ||||||||    
22155929 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 22156028  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
22156029 ttgaaaatagtccctg 22156044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 29019883 - 29019966
Alignment:
19 tatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    |||||||||||| ||||| || |||||| |||||||||||| ||  ||||||| || ||||||||||||||||||||||||||||    
29019883 tatatgatagatgaattacagacatttgtataacataactgattactaaaaaacct-caattactcttggtcatgaattcaaatt 29019966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 29678024 - 29678136
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  ||||||||| |||||||||| || ||||||||||||||||||||         |  ||||||||||||| |||||||||||||||||    
29678024 ggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgtaatttttatt--ttgtttttggtccttgcaaaatattttgttt 29678121  T
204 ttggaaatagtccct 218  Q
    |||  ||||||||||    
29678122 ttgataatagtccct 29678136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 39437109 - 39436994
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
39437109 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 39437010  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
39437009 ttgaaaatagtccctg 39436994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 51834608 - 51834722
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||          || |||||||||||||||||||||  ||||||||    
51834608 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatt-ttgtttttggtccctgcaaaaatttttgttt 51834706  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
51834707 ttgaaaatagtccctg 51834722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 21159453 - 21159567
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| ||||||||| |||          | |||||||||||||||| ||||| ||||||||    
21159453 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaaaaagaaaattttgtttttggtccctgtaaaattttttgttt 21159552  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
21159553 ttgaaaatagtccct 21159567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 22008892 - 22008802
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
22008892 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 22008802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 153
Target Start/End: Original strand, 35533281 - 35533328
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttag 153  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||    
35533281 ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttag 35533328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 43441268 - 43441358
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| |||||||||||||| |||||||||||||| ||||          |||||||||||||||||||||||    
43441268 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaaaaattttgttgtttttggtccctgcaaa 43441358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 218
Target Start/End: Complemental strand, 3361817 - 3361704
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| ||||||||||| |||||||||||||||||| |||             |||||||||||||||||||||| |||||||||    
3361817 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 3361718  T
205 tggaaatagtccct 218  Q
    || |||||||||||    
3361717 tgaaaatagtccct 3361704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 7957228 - 7957170
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||||||||| |||||||||||  | ||||||||||||||||||||    
7957228 ttggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgt 7957170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 217
Target Start/End: Original strand, 12673644 - 12673757
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  |||| ||| ||| ||||||| || ||||||||||||||||||||          | |||||||||||||||||||||| ||||||||    
12673644 ggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaaaaataaaattttgtttttggtccctgcaaaattttttgttt 12673743  T
204 ttggaaatagtccc 217  Q
    ||| ||||||||||    
12673744 ttgaaaatagtccc 12673757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 20757403 - 20757513
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||||| ||| ||||||||||| || |||||||||||||||||| |          |  ||||||||||||||||||||| |||||||||||    
20757403 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaat--tgtttttggtccctgcaaaattttttgtttttg 20757500  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
20757501 aaaatagtccctg 20757513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 218
Target Start/End: Complemental strand, 22156292 - 22156179
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| |||||||||    
22156292 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 22156193  T
205 tggaaatagtccct 218  Q
    || |||||||||||    
22156192 tgaaaatagtccct 22156179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 219
Target Start/End: Original strand, 29955300 - 29955413
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||| ||| ||||||||||| || |||||| |||||||||||||          | |||||||||||||||||||| | ||||||||||    
29955300 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt 29955399  T
206 ggaaatagtccctg 219  Q
    | ||||||||||||    
29955400 gaaaatagtccctg 29955413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 219
Target Start/End: Original strand, 30004454 - 30004567
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||| ||| ||||||||||| || |||||| |||||||||||||          | |||||||||||||||||||| | ||||||||||    
30004454 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt 30004553  T
206 ggaaatagtccctg 219  Q
    | ||||||||||||    
30004554 gaaaatagtccctg 30004567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 35177255 - 35177305
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    ||||||||||||||||||||| |||||||||||||| ||||||||||||||    
35177255 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 35177305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 474408 - 474320
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||| ||||          |||||||||||||||||||||||    
474408 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaaaaaatttgttgtttttggtccctgcaaa 474320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 3151818 - 3151863
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| |||||||||||||||||||||||    
3151818 ttgtttttggtccctgcaaaattttttgtttttggaaatagtccct 3151863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 4513620 - 4513507
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||  || |||||||||||||| ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
4513620 ggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaca--attgtttttggtccctgcaaaattttttgttt 4513523  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
4513522 tttaaaatagtccctg 4513507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 106 - 218
Target Start/End: Original strand, 14633547 - 14633659
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||| ||| ||||||||||| || ||||||||||||| |||||           | |||||||||||||||||||||| ||||||||||    
14633547 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctggtaaaaaaaaattttgtttttggtccctgcaaaattttttgttttt 14633646  T
206 ggaaatagtccct 218  Q
    | |||||||||||    
14633647 gaaaatagtccct 14633659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 28552383 - 28552295
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
28552383 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa 28552295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 30130158 - 30130267
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||            |||||||||||||||||||||| ||||||||    
30130158 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaa--attgtttttggtccctgcaaaattttttgttt 30130255  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
30130256 ttgaaaatagtc 30130267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 40545836 - 40545783
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||||| ||||||||||||||  |||||||||||||||||||    
40545836 taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgt 40545783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 51550082 - 51550170
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
51550082 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 51550170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 54608518 - 54608606
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
54608518 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa 54608606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 3152111 - 3152001
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||           | |||||||||||||||||||||| ||||||||    
3152111 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaat-ttgtttttggtccctgcaaaattttttgttt 3152013  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
3152012 ttgaaaatagtc 3152001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 9863404 - 9863348
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||||||||||||||| || ||||||||||||||||||||    
9863404 ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt 9863348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 13514577 - 13514525
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||||||||||  |||||||||||||| ||||||||||||||||    
13514577 ggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc 13514525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 106 - 217
Target Start/End: Complemental strand, 19297947 - 19297836
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||  ||||||||  || |||||||||| |||||| |||||||| ||||         ||||||||||||||||||||||||||||||  ||||    
19297947 ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtctctgtaaatttttgttgttgtttttggtccctgcaaaatattttactttt 19297848  T
206 ggaaatagtccc 217  Q
    | ||||||||||    
19297847 gaaaatagtccc 19297836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 25615975 - 25616031
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||    
25615975 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 25616031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 29446206 - 29446154
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||||||||||||||||||||||    
29446206 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc 29446154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 29490743 - 29490687
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||| ||||    
29490743 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt 29490687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 158
Target Start/End: Complemental strand, 29678389 - 29678333
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    ||||||||||||||||||||||| ||||||||||| | |||||||||||||| ||||    
29678389 ttggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct 29678333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 30268505 - 30268561
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||    
30268505 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 30268561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 34238598 - 34238712
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||| ||             |||||||||||||||||||||| ||||||||    
34238598 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 34238696  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
34238697 ttgaaaatagtccctg 34238712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 51759819 - 51759934
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| || | ||  |||||||||||||| ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
51759819 ggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 51759918  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
51759919 tttaaaatagtccctg 51759934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 53701663 - 53701607
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
53701663 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 53701607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 474198 - 474159
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
474198 ggtccctgcaaaatattttgtttttggaaatagtccctgc 474159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 3830516 - 3830402
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||| |||            ||||||||||||| |||||||| ||||||||    
3830516 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaaattgtttttggtccttgcaaaattttttgttt 3830417  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
3830416 ttgaaaatagtccct 3830402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 7518090 - 7518203
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| | || ||| ||||||||||| || ||||| |||||||||| |||         || |||||||||||||||||||||| ||||||||    
7518090 ggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgtaaaaaaaagtt-ttgtttttggtccctgcaaaattttttgttt 7518188  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
7518189 ttgaaaatagtccct 7518203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 8940315 - 8940276
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
8940315 ggtccctgcaaaatattttgtttttggaaatagtccctgc 8940276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 10977272 - 10977229
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||||||||||||||||||||||||| |||||||||    
10977272 ttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc 10977229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 12741117 - 12741156
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
12741117 ggtccctgcaaaatattttgtttttggaaatagtccctgc 12741156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 22008680 - 22008641
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
22008680 ggtccctgcaaaatattttgtttttggaaatagtccctgc 22008641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 22016198 - 22016159
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
22016198 ggtccctgcaaaatattttgtttttggaaatagtccctgc 22016159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 26089728 - 26089818
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
26089728 ttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 26089818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 31480502 - 31480412
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||  ||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
31480502 ttggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 31480412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 39071927 - 39071974
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||||    
39071927 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctgc 39071974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 216
Target Start/End: Original strand, 39132564 - 39132654
Alignment:
126 ctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||| | ||||||||||||||||||||         |||||||||||||||| || |||||||||| |||||| |||||||||    
39132564 ctgcaaatatgtttcgttttggttttagtccctgtcaattttttttgttgtttttggtccttgtaaaatattttatttttgaaaatagtcc 39132654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 46724901 - 46724846
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| ||||| ||||||||||||||| |||||||| |||||||||||||    
46724901 gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgt 46724846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 49323936 - 49323897
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
49323936 ggtccctgcaaaatattttgtttttggaaatagtccctgc 49323897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 50009284 - 50009171
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||| |||| ||||||||  |||||||||| || |||||| ||||| |||||||         || |||||||| ||||||||||||||||||||||    
50009284 ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaatttttgttt-ttgttttttgtccctgcaaaatattttgttt 50009186  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
50009185 ttgaaaatagtccct 50009171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 51550292 - 51550331
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
51550292 ggtccctgcaaaatattttgtttttggaaatagtccctgc 51550331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 275510 - 275556
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
275510 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 275556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 863649 - 863564
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| |||||||||||| | |||||| |||||||||||||         |||||||||||||||||||||||    
863649 taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 863564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 3387268 - 3387353
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| ||||| || |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
3387268 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgaaaaaaaaatttgttgtttttggtccctgcaaa 3387353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 3387476 - 3387514
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||||||||||||||||    
3387476 ggtccctgcaaaatattttgtttttggaaatagtccctg 3387514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 3830134 - 3830245
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| ||  |||||||||||||||||||            ||||||||||||| |||||||| ||||||||    
3830134 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaa----ttgtttttggtccttgcaaaattttttgttt 3830229  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
3830230 ttgaaaatagtccctg 3830245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 100 - 189
Target Start/End: Complemental strand, 4035057 - 4034968
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgc 189  Q
    |||||||||||||||| |||||||| ||||||||||| || ||||| |||||||| |||||         ||||||||||||||||||||    
4035057 aattggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgtaatttttttttgttgtttttggtccctgc 4034968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 4814898 - 4814787
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||||| |         |||||   ||||||||||||||||| ||||||||    
4814898 ggctaaaatatggttttagtc-ctgcaaatatgtctcgttttggttttagtccctataaaaaaaaattgtt---tttggtccctgcaaaattttttgttt 4814803  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
4814802 tttaaaatagtccctg 4814787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 215
Target Start/End: Original strand, 8510212 - 8510325
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| ||||||||||| ||  ||||||||||||||||||             |||||||||||||||||||||| ||||||    
8510212 ttggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgt 8510311  T
202 ttttggaaatagtc 215  Q
    ||||| ||||||||    
8510312 ttttgaaaatagtc 8510325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 103 - 192
Target Start/End: Original strand, 15979337 - 15979426
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
15979337 tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 15979426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 20907389 - 20907343
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
20907389 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 20907343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 28552173 - 28552135
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||||||||||||||||    
28552173 ggtccctgcaaaatattttgtttttggaaatagtccctg 28552135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 31869956 - 31869846
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||| ||||||||||||||            |||||||||||||||||||||  ||||||||    
31869956 ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaa--attgtttttggtccctgcaaaactttttgttt 31869859  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
31869858 ttgaaaatagtcc 31869846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 40279335 - 40279285
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||| ||||||||| |||||||||||||||||||| |||||||    
40279335 ggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt 40279285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 45161180 - 45161226
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
45161180 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 45161226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 45320688 - 45320734
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
45320688 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 45320734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 49324143 - 49324058
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| ||| |||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
49324143 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 49324058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 9262155 - 9262102
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||    
9262155 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc 9262102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 9597095 - 9597007
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||| || |||||||||||  | ||||||||||||||||||||         |||||||||||||||||||||||    
9597095 ggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 9597007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 9603629 - 9603717
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||| || ||||||||||| || |||||||||||||||||| |         |||||||||||||||||||||||    
9603629 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaattgttgtttttggtccctgcaaa 9603717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 10976977 - 10977092
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||| ||||||||||||||| |||||||    
10976977 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtaaaaaaaaaattgtttctggtccctgcaaaattttttgtt 10977075  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
10977076 tttgaaaatagtccctg 10977092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 20612898 - 20612785
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||          |  ||||||||||||| |||||| | ||||||||    
20612898 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaat--ttgtttttggtccttgcaaatttttttgttt 20612801  T
204 ttggaaatagtccctg 219  Q
    |||||||||| |||||    
20612800 ttggaaatagcccctg 20612785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 25710871 - 25710814
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
25710871 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 25710814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 26799888 - 26800000
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||| ||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
26799888 ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 26799987  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
26799988 ttgaaaatagtcc 26800000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 28427240 - 28427360
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||  |||||||||||||| |||||||||||||||||||             ||||||||||| |||| ||||| |||    
28427240 aaataggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggttcctgtaaaattttt 28427339  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||    
28427340 tgtttttgaaaatagtccctg 28427360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 219
Target Start/End: Complemental strand, 29955595 - 29955546
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||| |||||||||||||||||||| ||||||||||| ||||||||||||    
29955595 ttgtagtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 29955546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 188
Target Start/End: Complemental strand, 30034472 - 30034388
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctg 188  Q
    |||||||||||| ||||| ||  ||||||||||||| ||||||||||||||||||||         |||||||||||||||||||    
30034472 ggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctg 30034388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||    
40370589 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc 40370536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 201
Target Start/End: Original strand, 44802279 - 44802378
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||| |||||||||||  | |||||||||||||| |||||         ||||||||||||||||||| |||||||||||    
44802279 attggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctg-aaaatattttg 44802377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 183 - 220
Target Start/End: Original strand, 45002233 - 45002270
Alignment:
183 tccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||    
45002233 tccctgcaaaatattttgtttttggaaatagtccctgc 45002270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 47336228 - 47336316
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
47336228 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 47336316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 219
Target Start/End: Complemental strand, 53113697 - 53113648
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||||||||||||||  ||||| ||||||||||||    
53113697 ttgttgtttttggtccctgcaaaatattttacttttgaaaatagtccctg 53113648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 106 - 217
Target Start/End: Original strand, 2486581 - 2486692
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||| |||| ||| ||||||||||| ||  ||||||||||||| | |||         || ||||||||||||| ||||||||||||| |||||    
2486581 ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagttcatgtaattttatttttttgtttttggtccttgcaaaatattttattttt 2486680  T
206 ggaaatagtccc 217  Q
    | ||||||||||    
2486681 gaaaatagtccc 2486692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 3387604 - 3387552
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||    
3387604 ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc 3387552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 4513263 - 4513319
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
4513263 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 4513319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 7588318 - 7588374
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||  |||||||| ||||||||||| |||||||||||||||||| ||||    
7588318 ggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtctctgt 7588374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||| |||||||| ||||||||||| || |||||||||||||||||||    
8940522 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 8940470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 28427608 - 28427498
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
28427608 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 28427510  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
28427509 ttgaaaatagtc 28427498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 30106220 - 30106164
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||  || ||||||||||||||||||||    
30106220 ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt 30106164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 30424628 - 30424684
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||||||||| ||||||||| ||||    
30424628 ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgt 30424684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 31480290 - 31480254
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||||||||||||||||||    
31480290 ggtccctgcaaaatattttgtttttggaaatagtccc 31480254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 40545564 - 40545620
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||| ||||||||||||||    
40545564 ggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt 40545620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 46186771 - 46186656
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  |||||||||| || ||||||||||||||| ||||            ||||||||||||| |||||||| ||||||||    
46186771 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaatttgtttttggtccttgcaaaattttttgttt 46186672  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
46186671 ttgaaaatagtccctg 46186656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 48924240 - 48924184
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||| ||||||| || ||||||||||||||||||||    
48924240 ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgt 48924184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 52342371 - 52342331
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgct 221  Q
    |||||||||||||||||||||||||| ||||||||||||||    
52342371 ggtccctgcaaaatattttgtttttgaaaatagtccctgct 52342331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 52342583 - 52342531
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||||||||||||||| || ||||||||||||||||    
52342583 ggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc 52342531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 9261943 - 9261904
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||| |||||||||||||||||||||||    
9261943 ggtccctgcaaaatatgttgtttttggaaatagtccctgc 9261904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 9596759 - 9596814
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||| |||||||||||||||  | ||||||||||||||||||||    
9596759 gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgt 9596814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 194
Target Start/End: Complemental strand, 9603919 - 9603829
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||| |||||||| ||||||||||| ||  ||||||||||| || ||||         |||||||||||||||||||||||||    
9603919 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttattctctgtaaaagaaatttgttgtttttggtccctgcaaaat 9603829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 11311433 - 11311488
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||  ||||||||||||||||| ||  ||||||||||||||||||||    
11311433 gctaaaatatgacgttggtctctgcaaatatatccagttttggttttagtccctgt 11311488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 11463233 - 11463288
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||||||  ||||||||||| || ||||||||||||||||||||    
11463233 gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgt 11463288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 15979548 - 15979587
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||| ||||||||||    
15979548 ggtccctgcaaaatattttgtttttggaagtagtccctgc 15979587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 217
Target Start/End: Complemental strand, 30004750 - 30004703
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||| |||||||||||||||||||| ||||||||||| ||||||||||    
30004750 ttgtagtttttggtccctgcaaaattttttgtttttgaaaatagtccc 30004703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 202
Target Start/End: Original strand, 35936780 - 35936878
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||||||| || |||||||   | |||||||||||| |||| ||         |||||||||||||||||||||||||||||||||    
35936780 ggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccccgtaatttttttttgttgtttttggtccctgcaaaatattttgtt 35936878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 37506867 - 37506922
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
37506867 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37506922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 37507222 - 37507167
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
37507222 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37507167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 39288573 - 39288624
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||    
39288573 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 39288624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 45002021 - 45002076
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||| ||||    
45002021 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 45002076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 45005884 - 45005974
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||| ||||||||| ||||| || |||||||||||||| |||||| ||||||||||||          |||||||||||||||||||||||    
45005884 ttggttaaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa 45005974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 46622129 - 46622074
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| ||||||||  ||||||||||| | |||||||||||||||||||    
46622129 ggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg 46622074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 158
Target Start/End: Original strand, 3151750 - 3151804
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||    
3151750 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 3151804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 3151902 - 3151864
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||||||||||||||||    
3151902 ggtccctgcaaaattttttgtttttggaaatagtccctg 3151864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 4814540 - 4814650
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||| ||  |||         |  |||||||||||||||||||||| ||||||||    
4814540 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctgtgtaaaaaaaagt--ttgtttttggtccctgcaaaattttttgttt 4814637  T
204 ttggaaatagtcc 216  Q
    ||  |||||||||    
4814638 tttaaaatagtcc 4814650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 4950299 - 4950253
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| |||||| |||||    
4950299 ttgtttttggtccctgcaaaattttttgtttttgaaaataggccctg 4950253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 10778664 - 10778618
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||| |||||||||||||||| ||||||||||| ||||||||||||    
10778664 ttgttattggtccctgcaaaattttttgtttttgaaaatagtccctg 10778618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 13584072 - 13584118
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||  ||||||||||| ||||||||||||    
13584072 ttgtttttggtccctgcaaaaatttttgtttttgaaaatagtccctg 13584118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 16123137 - 16123195
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||| ||| ||| ||||||| || ||||||||||||||||||||    
16123137 ttggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt 16123195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 18175855 - 18175901
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||  ||||||||||||    
18175855 ttgtttttggtccctgcaaaattttttgtttttaaaaatagtccctg 18175901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #176
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 19656835 - 19656789
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||||||    
19656835 ttgtttttggtccttgcaaaattttttgtttttgaaaatagtccctg 19656789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #177
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 20644503 - 20644561
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||  |||||||| ||||||||||||||  ||||| |||||||||||||    
20644503 ttggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgt 20644561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #178
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 28942525 - 28942575
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||| |||| ||| ||||||||||| |||||||||||||||||    
28942525 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 28942575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #179
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 39288827 - 39288785
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||| ||||||||||| ||||||||||||    
39288827 ttttggtccctgcaaaattttttgtttttgaaaatagtccctg 39288785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #180
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 45313565 - 45313611
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||| ||||||||||||||||||||||||| |||||| |||||||||    
45313565 ttgtagtttttggtccctgcaaaatattttatttttgaaaatagtcc 45313611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #181
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 105 - 218
Target Start/End: Original strand, 46186410 - 46186523
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    |||||||||||||||| ||| ||||||||||| || |||||| ||||||||| |||            ||||||||||||| ||| |||| |||||||||    
46186410 gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttgtaaaaaaaaaaaattgtttttggtccatgcgaaattttttgtttt 46186509  T
205 tggaaatagtccct 218  Q
    || |||||||||||    
46186510 tgaaaatagtccct 46186523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #182
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 46901104 - 46901154
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||| |||| |||||||||||||||| | ||||||||||||||    
46901104 ggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt 46901154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #183
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 50196301 - 50196355
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
50196301 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 50196355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #184
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 51500618 - 51500572
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||  ||||||||||||    
51500618 ttgtttttggtccctgcaaaattttttgttttttaaaatagtccctg 51500572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #185
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 51834874 - 51834828
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||  ||||||||||| ||||||||||||    
51834874 ttgtttttggtccctgcaaaactttttgtttttgaaaatagtccctg 51834828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #186
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 205
Target Start/End: Original strand, 53701359 - 53701459
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| ||||  |||||||||||||| ||| |||| ||||||||||||||         ||||   |||||||||||||||||| ||||||    
53701359 ttggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgtaaaaaaaaattgt---ttttggtccctgcaaaattttttgt 53701455  T
202 tttt 205  Q
    ||||    
53701456 tttt 53701459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #187
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 1721092 - 1721145
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| ||||||||  |||||||||||||  |||||||||||||||||||    
1721092 taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgt 1721145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #188
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 220
Target Start/End: Complemental strand, 9596882 - 9596845
Alignment:
183 tccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||||| |||||||||||||    
9596882 tccctgcaaaatattttgtttttgaaaatagtccctgc 9596845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #189
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 14772211 - 14772264
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||||||| |||||||| |||||||||||  | |||||||||||||||||    
14772211 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc 14772264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #190
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 215
Target Start/End: Complemental strand, 20405042 - 20405009
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtc 215  Q
    ||||||||||||||||||||||||||||||||||    
20405042 gtccctgcaaaatattttgtttttggaaatagtc 20405009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #191
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 20405223 - 20405135
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||   ||||||| ||||||||||||||         |||||||||||||||| ||||||    
20405223 ggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgtaaatttttgttgttgtttttggtccttgcaaa 20405135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #192
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 35565508 - 35565596
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||| || ||||||||||  || ||||||||||||||||||||         || ||||||||||||||||||||    
35565508 ggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaattttttgttattgtttttggtccctgcaaa 35565596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #193
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    ||||||||||| |||||||| ||||||||||| ||| |||||||||||||    
36673244 gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt 36673195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #194
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 158
Target Start/End: Original strand, 50008921 - 50008974
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||| |||||| |||||||| |||||||||||| || |||||||||||||||||    
50008921 gctagaatatggttttggtccctgcaaatatgttttattttggttttagtccct 50008974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #195
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 54767171 - 54767259
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||  |||||| |||||| | || |||||||||||||||||||         |||||||||||||||||||||||    
54767171 ggctaaaatatggttttattctctgaaaatatattttcttttggttttagtccctgtaattttttgttgttgtttttggtccctgcaaa 54767259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #196
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 5345689 - 5345633
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||    
5345689 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 5345633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #197
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 219
Target Start/End: Complemental strand, 9863334 - 9863290
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||| |||||||| ||||||||||| ||||||||||||    
9863334 gtttttggtccttgcaaaattttttgtttttgaaaatagtccctg 9863290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #198
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 19844257 - 19844321
Alignment:
96 ttcaaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||| |||||||||||||| |||||||| || |||||||| || |||||  |||||||||||||    
19844257 ttcaagttggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgt 19844321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #199
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 20644876 - 20644761
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||| ||||||  |  |||||| |||||||||||||          ||||||||||| |||||||||||||||||  ||    
20644876 ggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgtaaaatttttgtgttgtttttgatccctgcaaaatattttactt 20644777  T
204 ttggaaatagtccctg 219  Q
     || ||||||||||||    
20644776 ctgaaaatagtccctg 20644761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #200
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 21553889 - 21553945
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||| ||||||| ||||||    
21553889 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgt 21553945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #201
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 25710510 - 25710624
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||| ||||||| |||| ||| |||||||||||||| |||||| |||||||||||||          | ||| | ||||| |||||||||| ||||||||    
25710510 ggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaat-ttgatattggttcctgcaaaattttttgttt 25710608  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
25710609 ttgaaaatagtccctg 25710624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #202
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 214
Target Start/End: Original strand, 26089910 - 26089942
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||||||||||||||    
26089910 gtccctgcaaaatattttgtttttggaaatagt 26089942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #203
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 29525105 - 29525157
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||||| ||||| ||||||||||    
29525105 ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc 29525157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #204
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 126 - 158
Target Start/End: Original strand, 30552168 - 30552200
Alignment:
126 ctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||||||||||||||||||||||||    
30552168 ctgcaaatatgtcttgttttggttttagtccct 30552200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #205
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 148
Target Start/End: Complemental strand, 44802548 - 44802504
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggt 148  Q
    |||||||||||||||||| || |||||||||||||| ||||||||    
44802548 ggctaaaatatgattttgatccctgcaaatatgtctcgttttggt 44802504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #206
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 218
Target Start/End: Complemental strand, 47902078 - 47902034
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||| ||||| ||||||||||| |||||||||||    
47902078 tgtttttggtccctgtaaaattttttgtttttgaaaatagtccct 47902034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #207
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 159
Target Start/End: Original strand, 49670477 - 49670529
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| |||  |||||||||| ||||||||||||||| ||||||    
49670477 taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctg 49670529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #208
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 218
Target Start/End: Complemental strand, 54767457 - 54767421
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||||||||| |||||||||||    
54767457 gtccctgcaaaatattttgtttttgaaaatagtccct 54767421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #209
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 275609 - 275644
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
275609 ttgtagtttttggtccctgcaaaatattttgttttt 275644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #210
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 4950200 - 4950165
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
4950200 ttgtagtttttggtccctgcaaaatattttgttttt 4950165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #211
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 5048183 - 5048218
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
5048183 ttgtagtttttggtccctgcaaaatattttgttttt 5048218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #212
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 10778565 - 10778530
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
10778565 ttgtagtttttggtccctgcaaaatattttgttttt 10778530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #213
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 10977145 - 10977180
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
10977145 ttgtagtttttggtccctgcaaaatattttgttttt 10977180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #214
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 13584171 - 13584206
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
13584171 ttgtagtttttggtccctgcaaaatattttgttttt 13584206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #215
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 14633720 - 14633685
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
14633720 ttgtagtttttggtccctgcaaaatattttgttttt 14633685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #216
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 15016580 - 15016545
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
15016580 ttgtagtttttggtccctgcaaaatattttgttttt 15016545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #217
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 15286337 - 15286302
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
15286337 ttgtagtttttggtccctgcaaaatattttgttttt 15286302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #218
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 18175954 - 18175989
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
18175954 ttgtagtttttggtccctgcaaaatattttgttttt 18175989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #219
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 20757566 - 20757601
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
20757566 ttgtagtttttggtccctgcaaaatattttgttttt 20757601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #220
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 22156097 - 22156132
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
22156097 ttgtagtttttggtccctgcaaaatattttgttttt 22156132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #221
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 156
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||| |||||||| ||||||||||| || |||||| |||||||||    
25610129 gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc 25610078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #222
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 25710705 - 25710670
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
25710705 ttgtagtttttggtccctgcaaaatattttgttttt 25710670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #223
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 28427441 - 28427406
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
28427441 ttgtagtttttggtccctgcaaaatattttgttttt 28427406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #224
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 28452376 - 28452321
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| || ||||||||  | |||||||||||||||||||    
28452376 ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg 28452321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #225
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 28942905 - 28942850
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||  ||||||||||| || |||||||||||||||||||    
28942905 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg 28942850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #226
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 29955466 - 29955501
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
29955466 ttgtagtttttggtccctgcaaaatattttgttttt 29955501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #227
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 30004620 - 30004655
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
30004620 ttgtagtttttggtccctgcaaaatattttgttttt 30004655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #228
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 30552311 - 30552346
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
30552311 ttgtagtttttggtccctgcaaaatattttgttttt 30552346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #229
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 30552478 - 30552423
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||  |||| |||  ||||||||||||| |||||||||||||||||||    
30552478 ggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg 30552423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #230
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 31724532 - 31724567
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
31724532 ttgtagtttttggtccctgcaaaatattttgttttt 31724567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #231
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 32119374 - 32119335
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||| |||||||||||||||||||||||||| |||||    
32119374 ggtccctacaaaatattttgtttttggaaatagttcctgc 32119335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #232
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 33794612 - 33794647
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
33794612 ttgtagtttttggtccctgcaaaatattttgttttt 33794647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #233
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 34582524 - 34582579
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||   |||||| |||||||||||||  |||||||||||||||||||    
34582524 ggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg 34582579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #234
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 36732643 - 36732690
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    ||||||| | |||||||| ||||||||||||||| |||||||||||||    
36732643 taaaataaggttttggtccctgcaaatatgtcttattttggttttagt 36732690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #235
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 37507034 - 37507069
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
37507034 ttgtagtttttggtccctgcaaaatattttgttttt 37507069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #236
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 39288732 - 39288697
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
39288732 ttgtagtttttggtccctgcaaaatattttgttttt 39288697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #237
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 39288898 - 39288843
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| ||||  || ||||||||||| || |||||||||||||||||||    
39288898 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 39288843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #238
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 40169344 - 40169399
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| ||||  || |||||||||||||| |||||| ||||||||||||    
40169344 ggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg 40169399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #239
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 40169486 - 40169451
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
40169486 ttgtagtttttggtccctgcaaaatattttgttttt 40169451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #240
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 45320813 - 45320778
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
45320813 ttgtagtttttggtccctgcaaaatattttgttttt 45320778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #241
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 45521716 - 45521751
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
45521716 ttgtagtttttggtccctgcaaaatattttgttttt 45521751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #242
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 46186603 - 46186568
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
46186603 ttgtagtttttggtccctgcaaaatattttgttttt 46186568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #243
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 49670671 - 49670636
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
49670671 ttgtagtttttggtccctgcaaaatattttgttttt 49670636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #244
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 217
Target Start/End: Complemental strand, 50196588 - 50196545
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||| ||||||||||| |||||||||||| ||||||||||    
50196588 tgtttttgatccctgcaaaaaattttgtttttgaaaatagtccc 50196545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #245
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 50261774 - 50261739
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
50261774 ttgtagtttttggtccctgcaaaatattttgttttt 50261739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #246
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 51500685 - 51500630
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| || | ||| ||||||||||| || |||||||||||||||||||    
51500685 ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg 51500630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #247
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 51834942 - 51834887
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| |||||||||||  | |||||||||||||||||||    
51834942 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 51834887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #248
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 151
Target Start/End: Original strand, 53113443 - 53113490
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    |||||||||||| |||||||| |||||||||||||| |||||| ||||    
53113443 ggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt 53113490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #249
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 53701526 - 53701561
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
53701526 ttgtagtttttggtccctgcaaaatattttgttttt 53701561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #250
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 219
Target Start/End: Complemental strand, 275766 - 275720
Alignment:
174 tgtttttggtccctgcaaaatattttg-tttttggaaatagtccctg 219  Q
    ||||||||||||||||||||| ||||| |||||| ||||||||||||    
275766 tgtttttggtccctgcaaaattttttgttttttgaaaatagtccctg 275720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #251
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 3361664 - 3361702
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
3361664 ggtccctgcaaaattttttgtttttgaaaatagtccctg 3361702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #252
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 7957154 - 7957112
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| |||||||||||||| ||||||||||| |||||||    
7957154 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 7957112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #253
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 8555235 - 8555193
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||| || |||||||||||||||||||||||||| |||||||    
8555235 ttttgatccctgcaaatatgtcttgttttggttttggtccctg 8555193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #254
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Original strand, 9603702 - 9603744
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| ||||||||||||||| |||||||||| |||||||    
9603702 ttttggtccctgcaaatatgtcttattttggttttggtccctg 9603744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #255
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 9863194 - 9863156
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| |||| |||||||||||||||||||    
9863194 ggtccctgcaaaattttttatttttggaaatagtccctg 9863156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #256
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 15016679 - 15016633
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||| | ||||||||||  ||||||||||||    
15016679 ttgtttttggtccctgcaaatttttttgttttttaaaatagtccctg 15016633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #257
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 16123350 - 16123388
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
16123350 ggtccctgcaaaattttttgtttttgaaaatagtccctg 16123388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #258
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 19656609 - 19656655
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||||   ||||||||||| ||||||||||||    
19656609 ttgtttttggtccctgcaaagctttttgtttttgaaaatagtccctg 19656655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #259
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 208
Target Start/End: Complemental strand, 20907290 - 20907252
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttgga 208  Q
    |||| |||||||||||||||||||| |||||||||||||    
20907290 ttgtagtttttggtccctgcaaaattttttgtttttgga 20907252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #260
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 21159607 - 21159569
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||||||| ||||||||||||    
21159607 ggtccctgcaaaaaattttgtttttgaaaatagtccctg 21159569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #261
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 25610058 - 25610016
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| |||||||||||||| ||||||||||| |||||||    
25610058 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 25610016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #262
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 28942686 - 28942716
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
28942686 gtttttggtccctgcaaaatattttgttttt 28942716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #263
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 160
Target Start/End: Original strand, 31869616 - 31869650
Alignment:
126 ctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| ||||||||||||||||||||    
31869616 ctgcaaatatgtctcgttttggttttagtccctgt 31869650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #264
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 31869785 - 31869755
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
31869785 gtttttggtccctgcaaaatattttgttttt 31869755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #265
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 37506935 - 37506981
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||  | ||||||||||| ||||||||||||    
37506935 ttgtttttggtccctgcaattttttttgtttttgaaaatagtccctg 37506981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #266
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 220
Target Start/End: Complemental strand, 39072046 - 39071996
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||| ||||||||||||||||||| |||||||||||  ||| |||||||||    
39072046 ttgtagtttttggtccctgcaaaaaattttgtttttaaaaaaagtccctgc 39071996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #267
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 39132834 - 39132792
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| |||||||||||||| ||||||||||| |||||||    
39132834 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 39132792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #268
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Original strand, 43440495 - 43440549
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| |||  ||||||||||||| ||||| ||||||||||||    
43440495 ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct 43440549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #269
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 156
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||| ||||| ||| ||||||||||| || ||||||||||||||||    
43440785 ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc 43440735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #270
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 47902147 - 47902089
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||  |||| ||| | |||||||||  ||||||||||||||||||||||    
47902147 ttggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctgt 47902089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #271
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 49670541 - 49670589
Alignment:
173 ttgtttttggtccctgcaaaa---tattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||   ||||||||||||| |||||||||||    
49670541 ttgtttttggtccctgcaaaattttattttgtttttgaaaatagtccct 49670589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #272
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 50196470 - 50196500
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
50196470 gtttttggtccctgcaaaatattttgttttt 50196500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #273
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 2439924 - 2439887
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
2439924 ggtccctgcaaaattttttgtttttgaaaatagtccct 2439887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #274
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 3830340 - 3830377
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
3830340 ggtccctgcaaaattttttgtttttgaaaatagtccct 3830377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #275
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 5048225 - 5048262
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
5048225 ggtccctgcaaaattttttgtttttgaaaatagtccct 5048262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #276
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 7518378 - 7518337
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||| |||||||||||| ||||||||||| ||||||||    
7518378 tgtttttgatccctgcaaaattttttgtttttgaaaatagtc 7518337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #277
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
110 aatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||| |||| ||| |||||||||||| | |||||||||||||||||||    
8510523 aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg 8510474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #278
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 10977187 - 10977224
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
10977187 ggtccctgcaaaattttttgtttttgaaaatagtccct 10977224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #279
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 12673796 - 12673759
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
12673796 ggtccctgcaaaattttttgtttttgaaaatagtccct 12673759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #280
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 14783956 - 14783993
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
14783956 ggtccctgcaaaattttttgtttttgaaaatagtccct 14783993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #281
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 19656694 - 19656657
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
19656694 ggtccctgcaaaattttttgtttttgaaaatagtccct 19656657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #282
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 205
Target Start/End: Original strand, 20124841 - 20124870
Alignment:
176 tttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||||||||||||||||||||||||    
20124841 tttttggtccctgcaaaatattttgttttt 20124870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #283
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 206
Target Start/End: Original strand, 20611088 - 20611121
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||||||||||||| |||||||||||    
20611088 ttgtttttggtccctgcaaaattttttgtttttg 20611121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #284
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 25710663 - 25710626
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
25710663 ggtccctgcaaaattttttgtttttgaaaatagtccct 25710626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #285
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 28942837 - 28942796
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||| ||||||||| ||||||||||| |||||||    
28942837 ttgtttttggtctctgcaaaattttttgtttttgaaaatagt 28942796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #286
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 30106010 - 30105973
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||| |||||||||||||||||| |||||||||||    
30106010 ggtccctccaaaatattttgtttttgaaaatagtccct 30105973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #287
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 30268691 - 30268728
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
30268691 ggtccctgcaaaattttttgtttttgaaaatagtccct 30268728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #288
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 35565719 - 35565756
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||||||| |||||| |||||||||||    
35565719 ggtccctgcaaaatattttatttttgaaaatagtccct 35565756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #289
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 39288690 - 39288653
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
39288690 ggtccctgcaaaattttttgtttttgaaaatagtccct 39288653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #290
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 39436899 - 39436862
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
39436899 ggtccctgcaaaattttttgtttttgaaaatagtccct 39436862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #291
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 45161116 - 45161169
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||  ||| |||||||||||||| ||||||||||||||| ||||    
45161116 taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgt 45161169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #292
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 170 - 219
Target Start/End: Original strand, 45161279 - 45161328
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||| ||||||||||| |||||||||||||||||||  ||| ||||||||    
45161279 ttgtagtttttggtccttgcaaaatattttgtttttaaaaaaagtccctg 45161328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #293
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 45521833 - 45521780
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||| |||| ||||||||||| | |||||||||||||| |||||    
45521833 taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt 45521780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #294
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 159
Target Start/End: Complemental strand, 49670808 - 49670747
Alignment:
99 aaattggctaaaatatgattttggtctc-tgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||||||| |||| ||| | ||||||||||  | |||||||||||||||||||    
49670808 aaattggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg 49670747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #295
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 50196662 - 50196601
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| |||||||||||| |||| ||| || |||||||| || ||||| ||||||||||||||    
50196662 aaataggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgt 50196601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #296
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 206
Target Start/End: Complemental strand, 51500512 - 51500483
Alignment:
177 ttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||||||||||||||||||||||||    
51500512 ttttggtccctgcaaaatattttgtttttg 51500483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #297
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 54767524 - 54767471
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||||||| ||  |||||||||| |||||| |||||||||||||    
54767524 taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgt 54767471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #298
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 154
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||| ||||  || |||||||||||||| ||||||||||||||    
7518444 ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt 7518396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #299
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 103
Target Start/End: Complemental strand, 26104508 - 26104480
Alignment:
75 tcaattactcttggtcatgaattcaaatt 103  Q
    |||||||||||||||||||||||||||||    
26104508 tcaattactcttggtcatgaattcaaatt 26104480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #300
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 199
Target Start/End: Complemental strand, 29686803 - 29686775
Alignment:
171 tgttgtttttggtccctgcaaaatatttt 199  Q
    |||||||||||||||||||||||||||||    
29686803 tgttgtttttggtccctgcaaaatatttt 29686775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #301
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 29955666 - 29955610
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| ||||||| |||| ||| ||||||||||| || |||||||||||||| |||||    
29955666 ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 29955610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #302
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 30004821 - 30004765
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| ||||||| |||| ||| ||||||||||| || |||||||||||||| |||||    
30004821 ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 30004765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #303
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 30034261 - 30034225
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||||||| ||||| ||||    
30034261 ggtccctgcaaaatattttgtttttgaaaataatccc 30034225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #304
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 34238807 - 34238843
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||| ||||||||||| ||||||||||    
34238807 ggtccctgcaaaattttttgtttttgaaaatagtccc 34238843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #305
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 35533619 - 35533567
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||||||||||||| || || || |||||||| |||||| ||||||||    
35533619 tggctaaaatatgattttgctccctacacatatgtctcgttttgattttagtc 35533567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #306
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 39132906 - 39132850
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||| |  | ||||||| |||||||||    
39132906 ggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgt 39132850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #307
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 40277822 - 40277878
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| || |||||||| |||||||||||  | |||||||||||| |||||||    
40277822 ggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgt 40277878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #308
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 40979710 - 40979654
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||  || ||||||||||| || |||||||||||| |||||||    
40979710 ggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgt 40979654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #309
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 46751271 - 46751323
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| ||||  || ||||||||||| || ||||||||||||||||    
46751271 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc 46751323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #310
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 219
Target Start/End: Original strand, 50196509 - 50196545
Alignment:
183 tccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||| |||||||||||| ||||||||||||    
50196509 tccctgcaaaaaattttgtttttgaaaatagtccctg 50196545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 75359 - 75475
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
75359 ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 75458  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
75459 ttggaaatagtccctgc 75475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 75764 - 75676
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
75764 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 75676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 75554 - 75515
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
75554 ggtccctgcaaaatattttgtttttggaaatagtccctgc 75515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 242)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 1614904 - 1614788
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
1614904 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 1614805  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
1614804 ttggaaatagtccctgc 1614788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 5234204 - 5234088
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| || ||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
5234204 ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 5234105  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
5234104 ttggaaatagtccctgc 5234088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 9659689 - 9659573
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
9659689 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 9659590  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
9659589 ttggaaatagtccctgc 9659573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 25988385 - 25988501
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
25988385 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgttt 25988484  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
25988485 ttggaaatagtccctgc 25988501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 8144295 - 8144409
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
8144295 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttgttt 8144394  T
204 ttggaaatagtccct 218  Q
    |||||||||||||||    
8144395 ttggaaatagtccct 8144409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 23399976 - 23399860
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||||||||| |||    
23399976 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatatttttttt 23399877  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
23399876 ttggaaatagtccctgc 23399860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 45228918 - 45228802
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||||||||||| ||||||||||||||    
45228918 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgtaaaatattttgttt 45228819  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
45228818 ttggaaatagtccctgc 45228802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 103 - 220
Target Start/End: Original strand, 27037592 - 27037709
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| ||||||||||| || ||||| |||||||||||||          |||||||||||||||||||||||||||||||||    
27037592 tggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt 27037691  T
203 tttggaaatagtccctgc 220  Q
    ||||||||||||||||||    
27037692 tttggaaatagtccctgc 27037709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 44568690 - 44568574
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
44568690 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgttt 44568591  T
204 ttggaaatagtccctgc 220  Q
    || ||||||||||||||    
44568590 tttgaaatagtccctgc 44568574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 204
Target Start/End: Original strand, 46828944 - 46829044
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
46828944 ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatattttgttt 46829043  T
204 t 204  Q
    |    
46829044 t 46829044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 48192488 - 48192372
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||| ||||||||||||||||||||||||    
48192488 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttctggtccctgcaaaatattttgttt 48192389  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
48192388 ttggaaatagtccctgc 48192372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 29198662 - 29198551
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
29198662 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 29198563  T
204 ttggaaatagtc 215  Q
    ||||||||||||    
29198562 ttggaaatagtc 29198551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 103 - 220
Target Start/End: Original strand, 35469879 - 35469996
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| ||||| || |||||||||||| | ||||||||||||||| ||||         |||||||||||||||||||||||||||||||||    
35469879 tggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaaaatttttttgttgtttttggtccctgcaaaatattttgtt 35469978  T
203 tttggaaatagtccctgc 220  Q
    |||| |||||||||||||    
35469979 tttgaaaatagtccctgc 35469996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 30223795 - 30223679
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||||||  |||||||||| || |||||||||||||||| |||         |||||||||||||||||||||||||||||| |||    
30223795 ggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatattttattt 30223696  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
30223695 ttggaaatagtccctgc 30223679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 41053842 - 41053958
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| ||  ||||| |||||||||||||         ||||||||||||||||||||||||||||||||||    
41053842 ggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 41053941  T
204 ttggaaatagtccctgc 220  Q
    ||| |||||||||||||    
41053942 ttgaaaatagtccctgc 41053958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 104 - 211
Target Start/End: Complemental strand, 48854070 - 48853963
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||||||||| || |||||||||||| | ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
48854070 ggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 48853971  T
204 ttggaaat 211  Q
    ||| ||||    
48853970 ttgaaaat 48853963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 104 - 206
Target Start/End: Complemental strand, 35838337 - 35838235
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||||||||| ||||||||||||||||||||||    
35838337 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgttttttgtccctgcaaaatattttgttt 35838238  T
204 ttg 206  Q
    |||    
35838237 ttg 35838235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 104 - 206
Target Start/End: Original strand, 5354768 - 5354870
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||| ||||||| || ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
5354768 ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 5354867  T
204 ttg 206  Q
    |||    
5354868 ttg 5354870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 107 - 215
Target Start/End: Original strand, 31503423 - 31503531
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||||| | ||| ||||||||||  |||||||||||||||||||         |||||||||||||||||||||||||||||||||||||    
31503423 taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatattttgtttttg 31503522  T
207 gaaatagtc 215  Q
     ||||||||    
31503523 aaaatagtc 31503531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 12932783 - 12932672
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||| |||||||||||||         ||||||||||||||||||||||||||||| ||||    
12932783 ggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaat-ttgttgtttttggtccctgcaaaatatttggttt 12932685  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
12932684 ttgaaaatagtcc 12932672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 105 - 220
Target Start/End: Complemental strand, 27458716 - 27458603
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||||||| |||| ||||||||||| || ||||| ||||||||||||||         |||||||||||||||||||||||||||||||||||    
27458716 gctaaaatatgattt-ggtc-ctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgtttt 27458619  T
205 tggaaatagtccctgc 220  Q
    || |||||||| ||||    
27458618 tgaaaatagtctctgc 27458603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 107 - 206
Target Start/End: Complemental strand, 39520727 - 39520628
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| ||||||||  ||||||||||||| |||||| |||||||||||||         |||||||||||||||||||||||||||||||||||||    
39520727 taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtttttg 39520628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 102 - 196
Target Start/End: Complemental strand, 16853591 - 16853497
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatat 196  Q
    |||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||    
16853591 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaataaaatttgttgtttttggtccctgcaaaatat 16853497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 28262713 - 28262827
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| ||  ||||||||||| |||||||         ||||||||||||||||||||||||||||||  ||    
28262713 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaaaaaaaagttgttgtttttggtccctgcaaaatattttactt 28262812  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
28262813 ttgaaaatagtccct 28262827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 107 - 213
Target Start/End: Original strand, 48192260 - 48192365
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||| ||||||||||||||||    
48192260 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgc-aaatattttgtttttg 48192358  T
207 gaaatag 213  Q
    |||||||    
48192359 gaaatag 48192365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 24717533 - 24717417
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| || | ||||||||| |||||||||||||||||| |         |||||||||||||||||| ||||||| |||| |    
24717533 tggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccctataaaaaaaaattgttgtttttggtccctacaaaataatttgct 24717434  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
24717433 tttgaaaatagtccctg 24717417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 204
Target Start/End: Complemental strand, 25092548 - 25092448
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| ||  ||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
25092548 ggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 25092449  T
204 t 204  Q
    |    
25092448 t 25092448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 27458399 - 27458487
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||||||    
27458399 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaacttgttgtttttggtccctgcaaa 27458487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 212
Target Start/End: Complemental strand, 34878125 - 34878017
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || |||||||||||||| |||||||||||| || ||||         ||||||||||||||||||| ||||||||||||||    
34878125 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatctctgtaaattttttttgttgtttttggtccctggaaaatattttgttt 34878026  T
204 ttggaaata 212  Q
    ||| |||||    
34878025 ttgaaaata 34878017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 188
Target Start/End: Complemental strand, 46759942 - 46759858
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctg 188  Q
    ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||    
46759942 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctg 46759858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 18022704 - 18022589
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| || |||||||||||||||| |||            |||||||||||||||||||||| ||||||||    
18022704 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaataaattgtttttggtccctgcaaaattttttgttt 18022605  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
18022604 ttgaaaatagtccctg 18022589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 194
Target Start/End: Original strand, 3975549 - 3975639
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||    
3975549 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaat 3975639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 489072 - 488961
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||            |||||||||||||||||||||| ||||||||    
489072 ggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaattttttgttt 488977  T
204 ttggaaatagtccctg 219  Q
    ||| |  |||||||||    
488976 ttgaatttagtccctg 488961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 17999721 - 17999610
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
17999721 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaattttttgttt 17999626  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
17999625 ttgaaaatagtccctg 17999610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 101 - 218
Target Start/End: Complemental strand, 39833239 - 39833122
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||  ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| |||||    
39833239 attggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaaagaaaaaactttgtttttggtccctgcaaaattttttg 39833140  T
201 tttttggaaatagtccct 218  Q
    |||||| |||||||||||    
39833139 tttttgaaaatagtccct 39833122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 1614559 - 1614647
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
1614559 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 1614647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 6892260 - 6892144
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt-nnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||||||| ||||||| |||||||||||||| ||||||||||||          |||||||||||| |||||||||||||||||  |    
6892260 ggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgtaattttttttttgttgtttttgatccctgcaaaatattttact 6892161  T
203 tttggaaatagtccctg 219  Q
    |||| ||| ||||||||    
6892160 tttgaaaagagtccctg 6892144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 25092160 - 25092248
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
25092160 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 25092248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 26877678 - 26877766
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
26877678 ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 26877766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 28911572 - 28911692
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||| ||||||||||| || ||||| ||||||||||||||            |||||||||||||||||||||| |||    
28911572 aaataggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttt 28911671  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||    
28911672 tgtttttgaaaatagtccctg 28911692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 6108334 - 6108449
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
6108334 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 6108433  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
6108434 ttgaaaatagtccctg 6108449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 21554753 - 21554639
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| ||||||||| |||||||||||||            |||||||||||||||||||||| ||||||||    
21554753 ggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 21554655  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
21554654 ttgaaaatagtccctg 21554639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 31310365 - 31310479
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| |||||||||| ||| ||||||||||||||| ||||            |||||||||||||||||||||| ||||||||    
31310365 ggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgtaaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 31310463  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
31310464 ttgaaaatagtccctg 31310479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 35015220 - 35015105
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||| ||||||||||||          || |||||||||||||||||||||| ||||||||    
35015220 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttgttt 35015121  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||| ||||    
35015120 ttgaaaatagttcctg 35015105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 44958506 - 44958450
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||    
44958506 ggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgt 44958450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 94 - 219
Target Start/End: Original strand, 10357991 - 10358117
Alignment:
94 aattcaaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt-nnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||| |||| |||||||||||||| || ||| ||||||||||| || ||||||||||||||||||||           | ||||||||||||||||||||    
10357991 aattaaaataggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaagttttgtttttggtccctgcaaa 10358090  T
193 atattttgtttttggaaatagtccctg 219  Q
    || ||||||||||  ||||||||||||    
10358091 attttttgttttttaaaatagtccctg 10358117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 194
Target Start/End: Complemental strand, 23676452 - 23676362
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||||    
23676452 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaat 23676362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 177 - 220
Target Start/End: Complemental strand, 25092451 - 25092408
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
25092451 ttttggtccctgcaaaatattttgtttttggaaatagtccctgc 25092408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 28528905 - 28529015
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||  ||| |||||||||| |||| |||||||||||||||         |||||||||| ||| |||||||||||||||||||    
28528905 ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgtaatttttt-ttgttgttttcggttcctgcaaaatattttgttt 28529003  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
28529004 ttgaaaatagtc 28529015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 35104078 - 35104133
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||    
35104078 ggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg 35104133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 37527421 - 37527366
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||||||| || ||||||||||||||||||||||||||||||||    
37527421 gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgt 37527366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 190
Target Start/End: Original strand, 46759658 - 46759744
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgca 190  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||| |||         |||||||||||||||||||||    
46759658 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgca 46759744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 23676135 - 23676220
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
23676135 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 23676220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 44344789 - 44344681
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||            |||||||||||||||||||||  ||||||||    
44344789 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaaatttttgttt 44344693  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
44344692 ttgaaaatagtc 44344681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 107 - 200
Target Start/End: Complemental strand, 6589271 - 6589180
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||| |||||||| ||||||||||| ||||||||||||||||||| |||         ||||||||||||||||||| |||||||||||    
6589271 taaaatatggttttggtccctgcaaatatgccttgttttggttttagtccatgt--aaaaaaattgttgtttttggtccctgtaaaatattttg 6589180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 8144658 - 8144570
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
8144658 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 8144570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 96 - 192
Target Start/End: Original strand, 9659347 - 9659443
Alignment:
96 ttcaaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||| |||||||||||| ||||| || |||||||||||||| |||||| ||||||||||||          |||||||||||||||||||||||    
9659347 ttcaaataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaaaagaatttgttgtttttggtccctgcaaa 9659443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 204
Target Start/End: Complemental strand, 11767275 - 11767175
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||  |  |||||||||||||||||||         ||||| ||||||||||||| ||||||||||||||    
11767275 ggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgtaaaaaaaatttgttatttttggtccctgaaaaatattttgttt 11767176  T
204 t 204  Q
    |    
11767175 t 11767175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 19783810 - 19783929
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||  |||| ||| |||||||||||||| |||||||||||||||| |||          | |||||||||||||||||||| | |||    
19783810 aaataggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaat-ttgtttttggtccctgcaaatttttt 19783908  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||    
19783909 tgtttttgaaaatagtccctg 19783929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 23399612 - 23399700
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
23399612 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 23399700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 25988749 - 25988661
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
25988749 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaacaaaaatttgttgtttttggtccctgcaaa 25988661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 29198303 - 29198391
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||| ||| |||||||||||||||||||          |||||||||||||||||||||||    
29198303 ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa 29198391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 30352563 - 30352675
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| ||| ||||||||||| || |||||||||| ||||||||          || |||||||| ||||||||||||| |||||||||||    
30352563 taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctggtaatttttttttttgtttttcgtccctgcaaaattttttgtttttg 30352662  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
30352663 aaaatagtccctg 30352675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 188
Target Start/End: Original strand, 35837924 - 35838008
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctg 188  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||| |||         |||||||||||||||||||    
35837924 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaatttgttgtttttggtccctg 35838008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 108 - 212
Target Start/End: Original strand, 37372441 - 37372544
Alignment:
108 aaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttgg 207  Q
    |||||||| |||| ||| |||||||||||||| ||||||||||||||||||||          | |||||||||||||||||||||| |||||||||||     
37372441 aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaact-ttgtttttggtccctgcaaaattttttgtttttga 37372539  T
208 aaata 212  Q
    |||||    
37372540 aaata 37372544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 37372904 - 37372791
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||| |||||          |  ||||||||||||||||||||| ||||||||    
37372904 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaaaaaaaaaat--tgtttttggtccctgcaaaattttttgttt 37372807  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
37372806 ttgaaaatagtccctg 37372791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 200
Target Start/End: Original strand, 38486478 - 38486574
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||||||||| ||| |||||||||| ||||| |||||||| ||| |         |||| ||||||||||||||||||||||||||    
38486478 ggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagttcctctaaaacaaatttgtcgtttttggtccctgcaaaatattttg 38486574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 39439029 - 39438941
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||| |||| |||||||||||||||||||          |||||||||||||||||||||||    
39439029 ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 39438941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 39719352 - 39719468
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| || |||||||| ||  |||||||||||||| ||||          | ||||||||||||||||||||| ||||||||    
39719352 tggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgtaaaaagaaaattttgtttttggtccctgcaaaagattttgtt 39719451  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
39719452 tttgaaaatagtccctg 39719468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 41054236 - 41054148
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| ||  |||||||||||||||||||         |||||||||||||||||||||||    
41054236 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa 41054148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 214
Target Start/End: Original strand, 6911082 - 6911193
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttg-ttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||||||  |  |||||||||| |||||| ||||||||| |||         ||  ||||||||||||||||||||||||||||||    
6911082 ggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtccttgtaaatttttttttattgtttttggtccctgcaaaatattttgtt 6911181  T
203 tttggaaatagt 214  Q
    |||| |||||||    
6911182 tttgaaaatagt 6911193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 218
Target Start/End: Complemental strand, 10358369 - 10358254
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| |||  |||||||||| || ||||||||||||||||||||            ||| |||||||||||||||||| |||||||    
10358369 tggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaagaattgattttggtccctgcaaaattttttgtt 10358270  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
10358269 tttgaaaatagtccct 10358254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 156
Target Start/End: Original strand, 13769770 - 13769826
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
13769770 aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 13769826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 19561450 - 19561394
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
19561450 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 19561394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 20388274 - 20388330
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| |||||||||||||||||||||||    
20388274 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 20388330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 219
Target Start/End: Original strand, 21554391 - 21554505
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    ||||||||||||||||||| ||| ||| ||||||| || |||||||||||||||| |||            |||||||||||||||||||||| ||||||    
21554391 ttggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttgtaaaaaaaaa---ttgtttttggtccctgcaaaatcttttgt 21554487  T
202 ttttggaaatagtccctg 219  Q
    ||||  ||||||||||||    
21554488 tttttaaaatagtccctg 21554505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 35210515 - 35210459
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
35210515 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 35210459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 39832906 - 39832962
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||    
39832906 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 39832962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 1614750 - 1614789
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
1614750 ggtccctgcaaaatattttgtttttggaaatagtccctgc 1614789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 5234018 - 5234057
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
5234018 ggtccctgcaaaatattttgtttttggaaatagtccctgc 5234057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 101 - 219
Target Start/End: Original strand, 7431948 - 7432066
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||| ||||||||||| || |||||||||||||||  ||             |||||||||||||||||||||| |||||    
7431948 attggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttggtaaaaaaaaaaattgtttttggtccctgcaaaattttttg 7432047  T
201 tttttggaaatagtccctg 219  Q
    |||||| ||||||||||||    
7432048 tttttgaaaatagtccctg 7432066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 8555799 - 8555685
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||| |||||||            |||||||||||||||||||||| ||||||||    
8555799 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaacaaaaattgtttttggtccctgcaaaattttttgttt 8555700  T
204 ttggaaatagtccct 218  Q
    ||  |||||||||||    
8555699 tttaaaatagtccct 8555685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 23399822 - 23399861
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
23399822 ggtccctgcaaaatattttgtttttggaaatagtccctgc 23399861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 25092370 - 25092409
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
25092370 ggtccctgcaaaatattttgtttttggaaatagtccctgc 25092409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 215
Target Start/End: Complemental strand, 25547492 - 25547381
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| |||||||||||||| |||||| |||||||||||||            ||||||||||||| |||||||| ||||||    
25547492 ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaa--attgtttttggtccttgcaaaattttttgt 25547395  T
202 ttttggaaatagtc 215  Q
    ||||| ||||||||    
25547394 ttttgaaaatagtc 25547381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 26878071 - 26878016
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||    
26878071 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 26878016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 30223461 - 30223516
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| | |||||||||||| |||||||||||||||||||    
30223461 ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg 30223516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 30709644 - 30709593
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||||||||||| ||| |||||||||||||| |||||||||||||||    
30709644 ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc 30709593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 106 - 218
Target Start/End: Original strand, 43058752 - 43058860
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||  |||| ||| ||||||||||||||||||||| |||||||||||||            ||||||||||||| |||||||| ||||||||||    
43058752 ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgtaaaaaaaa----ttgtttttggtccttgcaaaattttttgttttt 43058847  T
206 ggaaatagtccct 218  Q
    | |||||||||||    
43058848 gaaaatagtccct 43058860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 215
Target Start/End: Original strand, 44508718 - 44508829
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||          |  |||||||||||||||||||||  ||||||    
44508718 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaat--ttgtttttggtccctgcaaaaatttttgt 44508815  T
202 ttttggaaatagtc 215  Q
    ||||| ||||||||    
44508816 ttttgaaaatagtc 44508829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 44568536 - 44568575
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
44568536 ggtccctgcaaaatattttgtttttggaaatagtccctgc 44568575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 1007161 - 1007115
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
1007161 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 1007115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 103 - 218
Target Start/End: Original strand, 1974008 - 1974118
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| |||||||||||| | ||||||||||||||||||||            |||||||||||||||||||||| |||| ||    
1974008 tggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaat----ttgtttttggtccctgcaaaat-ttttatt 1974102  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
1974103 tttgaaaatagtccct 1974118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 103
Target Start/End: Complemental strand, 2746827 - 2746730
Alignment:
3 gttataagtatattactatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaat 102  Q
    |||||||||||||||   |||||||||||||| ||||  ||||||||||| ||| || || | ||||| | ||||||| |||||| ||||||||||||||    
2746827 gttataagtatatta---tatgatagataaatcataggtatttgcataacttaattgattatcaaaaatgtttcaattgctcttgatcatgaattcaaat 2746731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 201
Target Start/End: Original strand, 3807864 - 3807961
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||  |||||||  |||||||||||||| |||||||||||||| |||||         |||||||||||| ||| |||||||||||||||    
3807864 ggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgtaaaaagaatttgttgtttttgatccttgcaaaatattttgt 3807961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 8144448 - 8144410
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||||||||||||||||    
8144448 ggtccctgcaaaatattttgtttttggaaatagtccctg 8144410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 19561216 - 19561262
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
19561216 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 19561262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 30709392 - 30709438
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
30709392 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 30709438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 32189388 - 32189334
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||| ||||||||||||||| || ||||||||||||||||||||    
32189388 ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt 32189334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 1006833 - 1006890
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
1006833 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 1006890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 3975838 - 3975751
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||| |||||         |||||||||||||||||||||||    
3975838 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt-cctgtaaaaaaaatttgttgtttttggtccctgcaaa 3975751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 5233808 - 5233896
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||  | |||||||||||||||||||          |||||||||||||||||||||||    
5233808 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 5233896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 205
Target Start/End: Original strand, 6509208 - 6509311
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt--nnnnnnnnnttgttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||| |||| ||| ||||||||||| || ||||| ||||||||||||||           |||| |||||||||||||||||||||||||||    
6509208 ggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgtaaaaaaaataattgtagtttttggtccctgcaaaatattttgt 6509307  T
202 tttt 205  Q
    ||||    
6509308 tttt 6509311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 194
Target Start/End: Complemental strand, 16941054 - 16940962
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaat 194  Q
    |||| ||||||||| |||||||| ||||||||||| ||  |||||||||||||||||||         |||||||||||||||||| ||||||    
16941054 ttggataaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaatttgttgtttttggtccctacaaaat 16940962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 19757748 - 19757860
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnt-tgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||         | | ||||||||||||| |||||| | |||||||    
19757748 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaatttttttgttttgtttttggtccttgcaaattcttttgtt 19757847  T
203 tttggaaatagtc 215  Q
    |||| ||||||||    
19757848 tttgaaaatagtc 19757860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 151
Target Start/End: Complemental strand, 28529211 - 28529162
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    |||| ||||||||| ||||||||||||||||||||||| |||||||||||    
28529211 ttggttaaaatatggttttggtctctgcaaatatgtctcgttttggtttt 28529162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 39520398 - 39520486
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| ||||||||  | ||||||||||| ||||||||||||||||||||         |||||||||||||||||| ||||    
39520398 ggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctccaaa 39520486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 44568326 - 44568414
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||  || |||||||||||||||||||          |||||||||||||||||||||||    
44568326 ggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 44568414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 44841651 - 44841606
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||    
44841651 ttgtttttggtccctgtaaaatattttgtttttgaaaatagtccct 44841606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 46829313 - 46829256
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| ||||| || ||||||||||||||  |||||||||||||||||||    
46829313 tggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgt 46829256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 48852444 - 48852532
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || ||||| |||||||||| |||         |||||||||||||||||||||||    
48852444 ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttgtaaattttttttgttgtttttggtccctgcaaa 48852532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 2945845 - 2945789
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| || |||||||| || ||||||||||||||||||||    
2945845 ggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgt 2945789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 5308686 - 5308577
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||  || ||||||||||||||||||||          | |||||||||||||||||||||| ||||||||    
5308686 ggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgtaaaaaaaaaat-ttgtttttggtccctgcaaaattttttgttt 5308589  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
5308588 ttgaaaatagtc 5308577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 214
Target Start/End: Original strand, 6846851 - 6846895
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    ||||||||||||||||||| ||||||||||||||||| |||||||    
6846851 ttgttgtttttggtccctgtaaaatattttgtttttgaaaatagt 6846895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 7738911 - 7738827
Alignment:
19 tatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    ||||||| |||||||||| || |||||||||| | |||||| ||   |||||  | |||||||||||||||||||||||||||||    
7738911 tatatgacagataaattacagacatttgcatagcttaactgattacgaaaaagacctcaattactcttggtcatgaattcaaatt 7738827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 12894108 - 12894152
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||    
12894108 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccc 12894152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 12894402 - 12894346
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
12894402 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 12894346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 14543710 - 14543762
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||||||| ||||||||||||||  |||||||||||||||    
14543710 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc 14543762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 28911906 - 28911850
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
28911906 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 28911850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 218
Target Start/End: Complemental strand, 35015052 - 35015004
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||| |||||||||||||||||||| ||||||||||| |||||||||||    
35015052 ttgtagtttttggtccctgcaaaattttttgtttttgaaaatagtccct 35015004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 35104295 - 35104239
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| ||||||| |||||||| ||||||||||| || ||||||||||||||||||||    
35104295 ggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 35104239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 35210182 - 35210238
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||||||| || | ||||||||| || ||||||||||||||||||||    
35210182 ggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt 35210238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 38186761 - 38186709
Alignment:
104 ggctaaaatatgatttt-ggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||||||||||| |||| |||||||||||||| |||||||||||||||    
38186761 ggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc 38186709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 41364884 - 41364940
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||  ||||| ||||||||||| ||||||||||||||||||||    
41364884 ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt 41364940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 102 - 158
Target Start/End: Complemental strand, 44403251 - 44403195
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||||| |||| |||  ||||||||||||| ||||||||||||||||||    
44403251 ttggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct 44403195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 45073314 - 45073429
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||| | || |||||||||||| |||||||          | |||||||||||||||||||||| ||||||||    
45073314 ggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaaaaataaaattttgtttttggtccctgcaaaattttttgttt 45073413  T
204 ttggaaatagtccctg 219  Q
    ||  || |||||||||    
45073414 tttaaattagtccctg 45073429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 48359077 - 48359025
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||||| |||| ||| |||||||||||||| ||||||||||||||    
48359077 ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 48359025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 1559343 - 1559457
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  |||| ||| ||||||||||| || |||||| ||||| |||||||          | |||||||||||||||||||||| ||||||||    
1559343 ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgttaaaaaaacattttgtttttggtccctgcaaaattttttgttt 1559442  T
204 ttggaaatagtccct 218  Q
     || |||||||||||    
1559443 atgaaaatagtccct 1559457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 219
Target Start/End: Original strand, 5308321 - 5308439
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt-nnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||||||||||| |||| |||  ||||||||||||| ||||| ||||||||||||||             ||||||||| ||||||||||| ||||||    
5308321 ttggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaaaaatttgtttttgatccctgcaaaaaattttg 5308420  T
201 tttttggaaatagtccctg 219  Q
    |||||| ||||||||||||    
5308421 tttttgaaaatagtccctg 5308439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 214
Target Start/End: Original strand, 19005598 - 19005708
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  |||||||| ||| |||||||||| |||||| |||||||  || |         |||||||||||||||  |||||||||||||||||    
19005598 ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagttgctataaaattcttttgttgtttttggtctttgcaaaatattttgttt 19005697  T
204 ttggaaatagt 214  Q
    ||| |||||||    
19005698 ttgaaaatagt 19005708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 25988539 - 25988500
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||| ||||||||||||||||||||||||||||||||    
25988539 ggtccctacaaaatattttgtttttggaaatagtccctgc 25988500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 158
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    ||||||||| |||||||| ||| |||||||||| ||||||||||||||||||    
34877777 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct 34877828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 44509054 - 44508999
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
44509054 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 44508999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 46304387 - 46304328
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||  |||| ||| |||||||||||| | ||||||||||||||||||||    
46304387 attggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgt 46304328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 488781 - 488823
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||| ||||||||    
488781 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtc 488823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 1559638 - 1559592
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||||||    
1559638 ttgtttttggtccttgcaaaattttttgtttttgaaaatagtccctg 1559592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 6509470 - 6509360
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| || |||||||| || ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
6509470 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaaaaaaaa--attgtttttggtccctgcaaaattttttgttt 6509373  T
204 ttggaaatagtcc 216  Q
    ||  |||||||||    
6509372 tttaaaatagtcc 6509360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 156
Target Start/End: Original strand, 6589019 - 6589073
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||||| |||||||| ||||||||||| || ||||||||||| ||||    
6589019 ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc 6589073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 11767128 - 11767166
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||| ||||||||||||    
11767128 ggtccctgcaaaatattttgtttttgaaaatagtccctg 11767166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 17854151 - 17854205
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||| ||| ||||||||||||||  |||||||||||||||||||    
17854151 ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt 17854205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 28263069 - 28263015
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| ||||| || |||||||||||| |||||||| |||||||||||||    
28263069 ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgt 28263015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 215
Target Start/End: Original strand, 29198513 - 29198547
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||||||||||||||||    
29198513 ggtccctgcaaaatattttgtttttggaaatagtc 29198547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 107 - 192
Target Start/End: Complemental strand, 31503780 - 31503695
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||| |||| ||| |||||||||||||| |||||| |||||||| ||||         |||||||||||||||||||||||    
31503780 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgtaaaagaaatttgttgtttttggtccctgcaaa 31503695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 37952671 - 37952725
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||| ||| ||| ||||||||||| |||||||||||||||||||    
37952671 ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgt 37952725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 45021564 - 45021610
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||| |||||||||||| ||||||||||| ||||||||||||    
45021564 ttgtttttgctccctgcaaaattttttgtttttgaaaatagtccctg 45021610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 182 - 220
Target Start/End: Complemental strand, 46759792 - 46759754
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||| |||||||||||||    
46759792 gtccctgcaaaatattttgtttttgaaaatagtccctgc 46759754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 6892105 - 6892142
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||||||| |||||||||||    
6892105 ggtccctgcaaaatattttgtttttgaaaatagtccct 6892142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 16940762 - 16940850
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||| ||||| |||||||| ||||||||||| || | ||||||||||||||||||         |||||||||||||||| ||||||    
16940762 ggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgtaaaaaacaattgttgtttttggtccttgcaaa 16940850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 23817034 - 23816925
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||||||| |||||||||| |||||||| ||||| |||||            |||||||||||||||||||||| ||||||||    
23817034 ggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgtaaaaaaaaa--attgtttttggtccctgcaaaattttttgttt 23816937  T
204 ttggaaatagtc 215  Q
    ||  ||||||||    
23816936 tttaaaatagtc 23816925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 219
Target Start/End: Complemental strand, 31732382 - 31732337
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||    
31732382 tgtttttggttcctgcaaaattttttgtttttgaaaatagtccctg 31732337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 151
Target Start/End: Complemental strand, 37159906 - 37159861
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    |||||||||||||||||| ||||||||||||| | |||||||||||    
37159906 ctaaaatatgattttggtttctgcaaatatgtttcgttttggtttt 37159861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 45021787 - 45021746
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||| ||||||||||| |||||||    
45021787 ttgtttttggtccctgcaaaattttttgtttttgaaaatagt 45021746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 45073641 - 45073532
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||  |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||  ||||||||    
45073641 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa--attgtttttggtccctgcaaaaatttttgttt 45073544  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
45073543 ttgaaaatagtc 45073532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 192
Target Start/End: Complemental strand, 1271586 - 1271511
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||| |||||||||||    
1271586 ttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacttttttgttgtttttagtccctgcaaa 1271511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 6954862 - 6954914
Alignment:
108 aaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||| |||||||| |||||||||| ||| ||||||||||||||| ||||    
6954862 aaaatatggttttggtccctgcaaatatatctcgttttggttttagtctctgt 6954914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #156
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 17999465 - 17999521
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||| ||||||||    
17999465 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgt 17999521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 21223405 - 21223461
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||| ||| |||||||||||  | ||||||||||||||| ||||    
21223405 ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgt 21223461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 23816670 - 23816726
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||| ||||    
23816670 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgt 23816726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 214
Target Start/End: Original strand, 31732168 - 31732208
Alignment:
174 tgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    ||||||||||||||||||||| ||||||||||| |||||||    
31732168 tgtttttggtccctgcaaaattttttgtttttgaaaatagt 31732208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 35470033 - 35469997
Alignment:
184 ccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||| |||||||||||||    
35470033 ccctgcaaaatattttgtttttgaaaatagtccctgc 35469997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 35470069 - 35470033
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||||||| ||||||||||    
35470069 ggtccctgcaaaatattttgtttttgaaaatagtccc 35470033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||| |||| ||| ||| ||||||||||||||||||||||||||    
37953048 taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc 37953000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 38186519 - 38186483
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||||||| ||||||||||    
38186519 ggtccctgcaaaatattttgtttttgaaaatagtccc 38186483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 39719642 - 39719586
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||| ||||||||||||||    
39719642 ggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgt 39719586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 46304086 - 46304138
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||||||| ||  ||||||||||| || ||||||||||||||||    
46304086 ggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc 46304138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 46648715 - 46648667
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||||| |||| ||||||||||||||| || ||||||||||||    
46648715 ggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta 46648667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 488880 - 488915
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
488880 ttgtagtttttggtccctgcaaaatattttgttttt 488915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 218
Target Start/End: Original strand, 2945555 - 2945594
Alignment:
179 ttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||| |||||||||||||||||||| |||||||||||    
2945555 ttggtccttgcaaaatattttgtttttgaaaatagtccct 2945594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 220
Target Start/End: Original strand, 5234058 - 5234089
Alignment:
189 caaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||    
5234058 caaaatattttgtttttggaaatagtccctgc 5234089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 6079810 - 6079865
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||| ||| ||||||||||| || |||||| |||||||||||||    
6079810 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 6079865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #171
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 107 - 158
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    ||||||||| |||||||| ||||||||||| || ||||||||||| ||||||    
11766920 taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct 11766971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #172
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 12894235 - 12894200
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
12894235 ttgtagtttttggtccctgcaaaatattttgttttt 12894200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 14738937 - 14738890
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||| |||||| | ||||||||||| |||||||||||||    
14738937 ttgtttttggtccttgcaaatttttttgtttttgaaaatagtccctgc 14738890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 17999557 - 17999522
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
17999557 ttgtagtttttggtccctgcaaaatattttgttttt 17999522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 18022533 - 18022568
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
18022533 ttgtagtttttggtccctgcaaaatattttgttttt 18022568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 18311747 - 18311782
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
18311747 ttgtagtttttggtccctgcaaaatattttgttttt 18311782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 18311874 - 18311831
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||| ||||||||||| |||||||||||| |||||||||    
18311874 ttgtttttgatccctgcaaaaaattttgtttttgaaaatagtcc 18311831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 19465785 - 19465820
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
19465785 ttgtagtttttggtccctgcaaaatattttgttttt 19465820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 19561153 - 19561204
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    ||||||||||||| |||| ||| ||||||||||| || ||||||||||||||    
19561153 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 19561204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 19757917 - 19757952
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
19757917 ttgtagtttttggtccctgcaaaatattttgttttt 19757952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 28911745 - 28911780
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
28911745 ttgtagtttttggtccctgcaaaatattttgttttt 28911780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 31732098 - 31732157
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||| |||| ||| ||||||||||| || |||||| ||||| |||||||    
31732098 attggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgt 31732157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 31732284 - 31732249
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
31732284 ttgtagtttttggtccctgcaaaatattttgttttt 31732249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 32189228 - 32189193
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
32189228 ttgtagtttttggtccctgcaaaatattttgttttt 32189193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 35210345 - 35210310
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
35210345 ttgtagtttttggtccctgcaaaatattttgttttt 35210310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 37372738 - 37372703
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
37372738 ttgtagtttttggtccctgcaaaatattttgttttt 37372703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 39438741 - 39438792
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||||||| |||||||| ||| ||||||| || |||||||||||||||    
39438741 ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc 39438792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #188
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 39719521 - 39719556
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
39719521 ttgtagtttttggtccctgcaaaatattttgttttt 39719556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #189
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 43058877 - 43058912
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
43058877 ttgtagtttttggtccctgcaaaatattttgttttt 43058912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #190
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 156
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||| |||| ||  |||||||||||||| ||||||||||||||||    
43300613 gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc 43300664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #191
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 44508886 - 44508921
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
44508886 ttgtagtttttggtccctgcaaaatattttgttttt 44508921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #192
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 45021663 - 45021698
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
45021663 ttgtagtttttggtccctgcaaaatattttgttttt 45021698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #193
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 45073475 - 45073440
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
45073475 ttgtagtttttggtccctgcaaaatattttgttttt 45073440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 1007020 - 1006982
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
1007020 ggtccctgcaaaattttttgtttttgaaaatagtccctg 1006982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 1271304 - 1271346
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||| |||| |||||||||||||||||||| ||||||||    
1271304 ttgttttttgtccatgcaaaatattttgtttttgaaaatagtc 1271346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #196
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 1974154 - 1974124
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
1974154 gtttttggtccctgcaaaatattttgttttt 1974124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 155
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||| |||||||||||||| |||||||||||||||    
3808106 ttttggtccctgcaaatatgtctcgttttggttttagtc 3808068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 160
Target Start/End: Complemental strand, 3954176 - 3954138
Alignment:
122 gtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||||||| ||||||||||||||||||||    
3954176 gtctctgcatatatgtctcgttttggttttagtccctgt 3954138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #199
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 6108625 - 6108583
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||| ||||||||||||| ||||||||||| ||||||||||||    
6108625 ttttagtccctgcaaaattttttgtttttgaaaatagtccctg 6108583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #200
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 6847117 - 6847063
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||||||| |||||||||||  | ||||||||||||||| ||||    
6847117 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgt 6847063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #201
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 212
Target Start/End: Original strand, 9659536 - 9659566
Alignment:
182 gtccctgcaaaatattttgtttttggaaata 212  Q
    |||||||||||||||||||||||||||||||    
9659536 gtccctgcaaaatattttgtttttggaaata 9659566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #202
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 14738667 - 14738709
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||    
14738667 ttgtttttggtccttgcaaaattttttgtttttgaaaatagtc 14738709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #203
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Original strand, 14738808 - 14738846
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
14738808 ggtccctgcaaaattttttgtttttgaaaatagtccctg 14738846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #204
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 21223748 - 21223694
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| ||| ||||||||||  || ||||||||||||||||||    
21223748 ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct 21223694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #205
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 206
Target Start/End: Original strand, 22539930 - 22540023
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || || |||||||| ||  ||||||||||||| |||||         |||||||||||| | |||||||||||||||||||    
22539930 ggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt---------ttgttgtttttgattcctgcaaaatattttgttt 22540020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #206
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 152
Target Start/End: Original strand, 32189074 - 32189124
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    ||||||||||||||||||| ||| |||||||||||  | ||||||||||||    
32189074 ttggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta 32189124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #207
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 138
Target Start/End: Complemental strand, 36687263 - 36687229
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtc 138  Q
    ||||||||||||||||||||| |||||||||||||    
36687263 ggctaaaatatgattttggtccctgcaaatatgtc 36687229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #208
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 39438956 - 39438914
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| ||||||||||||||| |||||||||| |||||||    
39438956 ttttggtccctgcaaatatgtcttattttggttttggtccctg 39438914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #209
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 41365043 - 41365005
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||| ||||||||||| ||||||||    
41365043 ttttggtccctgcaaaattttttgtttttgaaaatagtc 41365005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #210
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 46304314 - 46304272
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||| ||||||||||||| ||||||||||| ||||||||    
46304314 ttgttttttgtccctgcaaaattttttgtttttgaaaatagtc 46304272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #211
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 1006903 - 1006948
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||||| |||||| ||||||||||  |||||||||||    
1006903 ttgtttttggtccctacaaaattttttgttttttaaaatagtccct 1006948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #212
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 205
Target Start/End: Complemental strand, 1559533 - 1559504
Alignment:
176 tttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||||||||||||||||||||||||    
1559533 tttttggtccctgcaaaatattttgttttt 1559504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #213
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 6887174 - 6887211
Alignment:
118 tttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||  |||||||||||||||||||||||||||||    
6887174 tttggtccttgcaaatatgtcttgttttggttttagtc 6887211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #214
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 10358212 - 10358249
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
10358212 ggtccctgcaaaattttttgtttttgaaaatagtccct 10358249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #215
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 12894193 - 12894156
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
12894193 ggtccctgcaaaattttttgtttttgaaaatagtccct 12894156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #216
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 105 - 154
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    ||||||||||| |||| ||| | |||||||||||| ||||||||||||||    
18022368 gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt 18022417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #217
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 19465827 - 19465864
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
19465827 ggtccctgcaaaattttttgtttttgaaaatagtccct 19465864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #218
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 20355408 - 20355461
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||||||||||||| ||  |||||||||| || ||||||||| |||||||    
20355408 ggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc 20355461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #219
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 28262867 - 28262830
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||| |||||||||||||||||||| |||||||||||    
28262867 ggtccatgcaaaatattttgtttttgaaaatagtccct 28262830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #220
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 156
Target Start/End: Original strand, 30709328 - 30709377
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||||| ||| || |||||||| || ||||||||||||||||    
30709328 taaaatatgattttagtccctacaaatatgcctcgttttggttttagtcc 30709377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #221
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 37159669 - 37159714
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    ||||| |||||||||| || ||||||||||||||||| ||||||||    
37159669 ttgttatttttggtccttgtaaaatattttgtttttgaaaatagtc 37159714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #222
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 37372696 - 37372659
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
37372696 ggtccctgcaaaattttttgtttttgaaaatagtccct 37372659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #223
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 38186369 - 38186422
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||||||| ||||||||||| || |||||| |||||| ||||||    
38186369 taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgt 38186422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #224
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 44344619 - 44344590
Alignment:
175 gtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||||||||||||||||||||||    
44344619 gtttttggtccctgcaaaatattttgtttt 44344590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #225
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 200
Target Start/End: Original strand, 44402960 - 44403056
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||||||||| |||| ||| ||||||||||| |   |||||||||||||||||||          | |||||||||||||||||||||| |||||    
44402960 ggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaaaaataaaattttgtttttggtccctgcaaaattttttg 44403056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #226
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 44508928 - 44508965
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
44508928 ggtccctgcaaaattttttgtttttgaaaatagtccct 44508965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #227
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 44841359 - 44841412
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| ||||| || ||||||||||| || |||||| |||||||||||||    
44841359 taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgt 44841412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #228
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 45021493 - 45021550
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgtttt-ggttttagtccctg 159  Q
    ||||||||||||| |||| ||| ||||||||||| || ||||| ||||||||||||||    
45021493 tggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg 45021550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #229
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 1559705 - 1559649
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || |||||  |||||||||||||    
1559705 ggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgt 1559649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #230
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 5355114 - 5355066
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||| |||| |||||||| ||||||||||| || |||||||||||||||    
5355114 taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc 5355066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #231
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 8555607 - 8555655
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||||||  |||| || |||||||||||| |||||||||||||||    
8555607 ggctaaaatatagttttagtttctgcaaatatgacttgttttggtttta 8555655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #232
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 13770081 - 13770025
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| |  |||||||||||||| |||||    
13770081 ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgt 13770025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #233
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 18927096 - 18927040
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    ||||||||||||||||  |||| ||| ||||||||||||||  |||| |||||||||    
18927096 aaattggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc 18927040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #234
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 19005865 - 19005825
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||| |||||||||||||| ||||||||||| |||||    
19005865 ttttggtccctgcaaatatgtctcgttttggttttggtccc 19005825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #235
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 205
Target Start/End: Original strand, 19465686 - 19465718
Alignment:
173 ttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||| ||||||||||    
19465686 ttgtttttggtccctgcaaaattttttgttttt 19465718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #236
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 19465980 - 19465925
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| | | |||||||||||||| |||| |||||||||||||||    
19465980 ggctaaaatatggttttagcc-ctgcaaatatgtctcgtttcggttttagtccctgt 19465925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #237
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 218
Target Start/End: Original strand, 20388441 - 20388489
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||| ||||||||||| |||||||||||||||||||  |||| ||||||    
20388441 ttgtagtttttggtccttgcaaaatattttgttttttaaaatggtccct 20388489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #238
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 159
Target Start/End: Complemental strand, 30352905 - 30352849
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||  |||| ||| ||||||||||| || |||||| ||||||||||||    
30352905 tggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg 30352849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #239
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 202
Target Start/End: Complemental strand, 31310512 - 31310480
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||| ||||||||||||||||||||||||||||    
31310512 ttgtagtttttggtccctgcaaaatattttgtt 31310480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #240
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 35470280 - 35470224
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| || ||||| || ||||||||||| ||  |||||||||||||||||||    
35470280 ggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgt 35470224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #241
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 35665877 - 35665933
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||  || || |||||||| || ||||||||||||||||||||    
35665877 ggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgt 35665933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #242
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 41365146 - 41365102
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    ||||||||||||| |||||||| ||||||||||  ||||||||||    
41365146 ttgtttttggtccttgcaaaattttttgttttttaaaatagtccc 41365102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 211)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 21993787 - 21993903
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||| || |||||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
21993787 ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt 21993886  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
21993887 ttggaaatagtccctgc 21993903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 104 - 217
Target Start/End: Original strand, 6412218 - 6412331
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
6412218 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttgttt 6412317  T
204 ttggaaatagtccc 217  Q
    ||||||||||||||    
6412318 ttggaaatagtccc 6412331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 22543354 - 22543470
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
22543354 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt 22543453  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
22543454 ttggaaatagtccctgc 22543470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 21385584 - 21385468
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| ||  ||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
21385584 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgttt 21385485  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
21385484 ttggaaatagtccctgc 21385468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 3414387 - 3414502
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||| |||||||||||||||||    
3414387 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttgttt 3414486  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
3414487 ttgaaaatagtccctg 3414502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 18024375 - 18024264
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||         ||||||||||| |||| |||||||||||||||||    
18024375 ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaaaaaaatttgttgttttttgtccttgcaaaatattttgttt 18024276  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
18024275 ttgaaaatagtc 18024264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 3969009 - 3968893
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | |||    
3969009 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattttt 3968910  T
204 ttggaaatagtccctgc 220  Q
    |||||||| ||||||||    
3968909 ttggaaatcgtccctgc 3968893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 20467718 - 20467602
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||| ||||          |||||||||||| |||||||||||||||||||||    
20467718 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaaaaaaatttgttgtttttgatccctgcaaaatattttgttt 20467619  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
20467618 ttggaaatagtccctgc 20467602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 25137357 - 25137242
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         ||||||||||| ||||||||||||| ||||||||    
25137357 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaatttttttttgttgtttttagtccctgcaaaatgttttgttt 25137258  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
25137257 ttgaaaatagtccctg 25137242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 17765009 - 17765126
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnn-ttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||  ||||          |||||||||||||||||||||||||||||||||    
17765009 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt 17765108  T
203 tttggaaatagtccctgc 220  Q
    |||| |||||||||||||    
17765109 tttgaaaatagtccctgc 17765126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 12299140 - 12299026
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||| |||||         ||||||||| ||||||||||||||||||||| ||    
12299140 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttctggtccctgcaaaatattttggtt 12299041  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
12299040 ttgaaaatagtccct 12299026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 23502540 - 23502426
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||| |||||||         ||||||||||| ||||||||||||||||||||||    
23502540 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgtaattttttgttgttgttttttgtccctgcaaaatattttgttt 23502441  T
204 ttggaaatagtccct 218  Q
    ||| ||||| |||||    
23502440 ttgaaaataatccct 23502426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 34582528 - 34582644
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | |||||||||||||||||||||| |||||||    
34582528 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaaattttttgtt 34582627  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
34582628 tttgaaaatagtccctg 34582644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 103 - 218
Target Start/End: Original strand, 19267564 - 19267679
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| ||| |||||||  | ||||||||||||||||||||         ||| |||||||||||| ||||||||||||||||    
19267564 tggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgtgaaaaaaatttgctgtttttggtccttgcaaaatattttgtt 19267663  T
203 tttggaaatagtccct 218  Q
    |||| |||||||||||    
19267664 tttgaaaatagtccct 19267679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 12757610 - 12757724
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||| ||||         || ||||||||||||||| |||||||||||  ||    
12757610 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgtaattttttttttttgtttttggtccctacaaaatattttactt 12757709  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
12757710 ttgaaaatagtccct 12757724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 105 - 215
Target Start/End: Complemental strand, 30479421 - 30479311
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||||||   |||||||||| || ||||||||||||||||||||         |||||||||||||||| ||||||||||||||||||    
30479421 gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttggtccttgcaaaatattttgtttt 30479322  T
205 tggaaatagtc 215  Q
    || ||||||||    
30479321 tgaaaatagtc 30479311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 101 - 218
Target Start/End: Complemental strand, 19690762 - 19690646
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||| |||||||| |||||||| |||||||||||||| |||||| ||||||||| |||         |||||| ||||||||||| ||||||||||||    
19690762 attggcgaaaatatggttttggtccctgcaaatatgtctcgttttg-ttttagtccgtgtaatttttttttgttgcttttggtccctacaaaatattttg 19690664  T
201 tttttggaaatagtccct 218  Q
    |||||| |||||||||||    
19690663 tttttgaaaatagtccct 19690646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 30929045 - 30928931
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||         |  ||||||||||||| |||||||| |||||||    
30929045 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaat--ttgtttttggtccttgcaaaattttttgtt 30928948  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
30928947 tttgaaaatagtccctg 30928931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 103 - 191
Target Start/End: Original strand, 10910628 - 10910716
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaa 191  Q
    ||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||         ||||||||||||||||||||||    
10910628 tggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaa 10910716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 10910964 - 10910876
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||||||||||||||    
10910964 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaataaatttgttgtttttggtccctgcaaa 10910876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 8169787 - 8169902
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt-nnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||||||  ||||||||||| |||||||| ||||| |||||||          |||||||||||||||| ||||||||||||||||    
8169787 ggctaaaatatgattttggtccatgcaaatatgttttgttttgattttactccctgtaattttttttttgttgtttttggtccatgcaaaatattttgtt 8169886  T
203 tttggaaatagtccct 218  Q
    |||  |||||||||||    
8169887 tttaaaaatagtccct 8169902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 19321131 - 19321016
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||  ||||         ||||||||||||||| ||| ||||||||||||||    
19321131 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttactgtaatttttt-ttgttgtttttggtcgctgtaaaatattttgttt 19321033  T
204 ttggaaatagtccctgc 220  Q
    ||| |||||||||||||    
19321032 ttgaaaatagtccctgc 19321016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 25431854 - 25431743
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||             ||||||||||||||||||||| ||||||||    
25431854 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa----tgtttttggtccctgcaaaattttttgttt 25431759  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
25431758 ttgaaaatagtccctg 25431743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 170 - 220
Target Start/End: Original strand, 3276091 - 3276141
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||    
3276091 ttgttgtttttggtccctgcaaaatattttgtttttgtaaatagtccctgc 3276141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 11925737 - 11925854
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt-nnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    |||||||| |||||||||||||| |||||||||||||| |||||| |||||||| ||||          ||||||||||| ||||||  |||||||||||    
11925737 ttggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtctctgtaaatttttttttgttgttttttgtccctataaaatattttg 11925836  T
201 tttttggaaatagtccct 218  Q
    |||||| |||||||||||    
11925837 tttttgaaaatagtccct 11925854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 23770157 - 23770275
Alignment:
100 aattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatatttt 199  Q
    |||| ||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||            ||||||||||||| |||||||| ||||    
23770157 aatttgctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa--attgtttttggtccttgcaaaatttttt 23770254  T
200 gtttttggaaatagtccctgc 220  Q
    ||||||| |||||||||||||    
23770255 gtttttgaaaatagtccctgc 23770275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 3968645 - 3968733
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
3968645 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 3968733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 17765375 - 17765287
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||||||||| |||||||||||||| |||||  |||||||||||||         |||||||||||||||||||||||    
17765375 ggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgtaaatttttgttgttgtttttggtccctgcaaa 17765287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 19129520 - 19129432
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    ||||||||||||||||||||| |||||||||||||  ||||||||||||||||||||         || ||||||||||||||||||||    
19129520 ggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaa 19129432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 19296412 - 19296292
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    ||||||||||||||||| |||| ||| ||||||||||| || |||||||||||| |||||||          | ||||||| |||||||| ||||| |||    
19296412 aaattggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaagaaaattttgttttcggtccctggaaaattttt 19296313  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||    
19296312 tgtttttgaaaatagtccctg 19296292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 21385251 - 21385339
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
21385251 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaa 21385339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 22543718 - 22543630
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
22543718 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa 22543630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 8680775 - 8680890
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
8680775 ggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 8680874  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
8680875 ttgaaaatagtccctg 8680890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 19690393 - 19690449
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||    
19690393 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 19690449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 214
Target Start/End: Original strand, 11448537 - 11448646
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| |||||||||||||| ||||||||||||||||| ||            |||||||||||||||||||||| ||||||||    
11448537 ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaaaaaaaaa-aattgtttttggtccctgcaaaattttttgttt 11448635  T
204 ttggaaatagt 214  Q
    ||| |||||||    
11448636 ttgaaaatagt 11448646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 107 - 205
Target Start/End: Complemental strand, 12176640 - 12176542
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||          | |||||||||||||||||||||| ||||||||||    
12176640 taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgttttt 12176542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 192
Target Start/End: Original strand, 13617531 - 13617617
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||    
13617531 ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa 13617617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 15962027 - 15962141
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  |||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
15962027 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgcagaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 15962126  T
204 ttggaaatagtccct 218  Q
    |||||||||||||||    
15962127 ttggaaatagtccct 15962141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 103 - 212
Target Start/End: Original strand, 30239292 - 30239399
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||| ||  |||||||||||||| |||||||||||||||||| |         |  |||||||||||||||||||||| |||||||    
30239292 tggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccctataaaaaacaat--ttgtttttggtccctgcaaaattttttgtt 30239389  T
203 tttggaaata 212  Q
    |||| |||||    
30239390 tttgaaaata 30239399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 1214996 - 1214942
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||    
1214996 ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct 1214942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 1007124 - 1007212
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| |||||||||||  | ||||||||||||||||||||         |||||||||||||||||||||||    
1007124 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa 1007212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 1007514 - 1007453
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||    
1007514 aaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 1007453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 3414752 - 3414664
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||| |||||||||| |||||||||||||||||||          |||||||||||||||||||||||    
3414752 ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa 3414664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 5286883 - 5286838
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||||||||||||||| |||||||||||    
5286883 ttgtttttggtccctgcaaaatattttgtttttgaaaatagtccct 5286838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 7156160 - 7156048
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
7156160 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 7156061  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
7156060 ttgaaaatagtcc 7156048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 12419943 - 12419823
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| ||||  || ||||||||||| || |||||||||||||||||||             ||||||||| ||||||||||||||||    
12419943 aaataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttgatccctgcaaaatattt 12419844  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||    
12419843 tgtttttgaaaatagtccctg 12419823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 15443270 - 15443225
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||    
15443270 ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtc 15443225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 20467561 - 20467602
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgctg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||    
20467561 ggtccctgcaaaatattttgtttttggaaatagtccctgctg 20467602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 21994403 - 21994315
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
21994403 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa 21994315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 102 - 155
Target Start/End: Original strand, 24901237 - 24901290
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||||||||| |||||||| |||||||||||||| |||||||||||||||    
24901237 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 24901290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 30038020 - 30037975
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||||||||||||||| |||||||||||    
30038020 ttgtttttggtccctgcaaaatattttgtttttgaaaatagtccct 30037975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 31198615 - 31198703
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||          |||||||||||||||||||||||    
31198615 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaattttgttgttgtttttggtccctgcaaa 31198703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 3276354 - 3276302
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||    
3276354 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 3276302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 9896637 - 9896585
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||||||||||||||||||||||    
9896637 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc 9896585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 216
Target Start/End: Original strand, 10091039 - 10091145
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| ||| |||||||||||| | ||||||||||||||||||||         ||||   |||||||||||||||||| |||||||||||    
10091039 taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgt---ttttggtccctgcaaaattttttgtttttg 10091135  T
207 gaaatagtcc 216  Q
     |||||||||    
10091136 aaaatagtcc 10091145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 14656260 - 14656204
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||||||  ||||||||||||| ||||||||||||||||||||    
14656260 ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt 14656204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 15076204 - 15076090
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
15076204 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgttt 15076106  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
15076105 ttgaaaatagtccctg 15076090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 15722610 - 15722666
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||||||| ||||||||||||| |||||| |||||||||||||    
15722610 ggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgt 15722666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 24209340 - 24209241
Alignment:
1 tggttataagtatattactatatgatagataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaa 100  Q
    |||||||||||||||||   ||| |||||||||||| |  |||||||||||| ||| || ||   ||||| |||||||||||| ||||||||||||||||    
24209340 tggttataagtatatta---tatcatagataaattacatgcatttgcataacttaattgattacaaaaaatgcttcaattactattggtcatgaattcaa 24209244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 94 - 219
Target Start/End: Complemental strand, 24692989 - 24692867
Alignment:
94 aattcaaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaa 193  Q
    ||||||| | |||||||||||| |||| ||| |||||||||||||| |||||| ||||||||||||             |||||||||||| ||||||||    
24692989 aattcaactaggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgcaaaaaaaaa---ttgtttttggtctctgcaaaa 24692893  T
194 tattttgtttttggaaatagtccctg 219  Q
    | ||||||||||| ||||||||||||    
24692892 ttttttgtttttgaaaatagtccctg 24692867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 24901554 - 24901498
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||||||| || |||||||| ||| |||||||||||||||||||    
24901554 ggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgt 24901498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 25136994 - 25137050
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||    
25136994 ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgt 25137050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 206
Target Start/End: Original strand, 30928681 - 30928781
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||          |  ||||||||||||||||||||| ||||||||    
30928681 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaat--tgtttttggtccctgcaaaattttttgttt 30928778  T
204 ttg 206  Q
    |||    
30928779 ttg 30928781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 31398541 - 31398427
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||||||  ||||||||||||||| |||          | | ||||||||||||||||| || ||||||||    
31398541 ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttgtaaaaaaaaaat-tagtttttggtccctgcaatattttttgttt 31398443  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
31398442 ttgaaaatagtccctg 31398427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 3968855 - 3968894
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
3968855 ggtccctgcaaaatattttgtttttggaaatagtccctgc 3968894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 6468310 - 6468423
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||  ||||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
6468310 ggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgtgaaaaaaaa-aattgtttttggtccctgcaaaattttttgttt 6468408  T
204 ttggaaatagtccct 218  Q
    ||  |||||||||||    
6468409 tttaaaatagtccct 6468423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 8170151 - 8170100
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||    
8170151 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 8170100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 8681116 - 8681061
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| ||||||||||||||||||||||    
8681116 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 8681061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 21993982 - 21993943
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
21993982 ggtccctgcaaaatattttgtttttggaaatagtccctgc 21993943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 22543508 - 22543469
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
22543508 ggtccctgcaaaatattttgtttttggaaatagtccctgc 22543469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 219
Target Start/End: Original strand, 31166871 - 31166984
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    ||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| |||||||||    
31166871 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaataaaa-ttgtttttggtccctgcaaaattttttgtttt 31166969  T
205 tggaaatagtccctg 219  Q
    || ||||||||||||    
31166970 tgaaaatagtccctg 31166984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 117 - 159
Target Start/End: Original strand, 1214767 - 1214809
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| ||||||||||||||||||||||||||||||||||    
1214767 ttttggtccctgcaaatatgtcttgttttggttttagtccctg 1214809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 1890128 - 1890174
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
1890128 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 1890174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 2616167 - 2616121
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
2616167 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 2616121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 6412369 - 6412331
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||||||||||||||||    
6412369 ggtccctgcaaaatattttgtttttggaaatagtccctg 6412331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 15116740 - 15116786
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
15116740 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 15116786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 15962391 - 15962333
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
15962391 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 15962333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 17321619 - 17321573
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
17321619 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 17321573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 18024009 - 18024067
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| ||||||||| ||||||||| |||||||||| || ||||||||||||||||||||    
18024009 ttggataaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgt 18024067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 24273906 - 24273952
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
24273906 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 24273952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 543724 - 543612
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| |||||||||||  |||||||||||||| ||||||             |||||||||||||||||||||| |||| |||    
543724 ggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggtaaaaaaataatttgtttttggtccctgcaaaattttttattt 543625  T
204 ttggaaatagtcc 216  Q
    ||| |||||||||    
543624 ttgaaaatagtcc 543612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 6412579 - 6412491
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||||| || |||||| ||||||||||||          |||||||||||||||||||||||    
6412579 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 6412491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 1890384 - 1890340
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||    
1890384 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccc 1890340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 2373179 - 2373235
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| |||||||||||| ||||||||||    
2373179 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgt 2373235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 2615938 - 2615982
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||    
2615938 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccc 2615982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 102 - 158
Target Start/End: Original strand, 12298820 - 12298876
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||| ||||||||| |||||||| |||||||||||||| ||||| ||||||||||||    
12298820 ttggttaaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct 12298876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 21147404 - 21147460
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||| |||||||||||  | ||||||||||||||||||||    
21147404 ggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgt 21147460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 25121496 - 25121440
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||  |||||||||||| | ||||||||||||||||||||    
25121496 ggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgt 25121440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 33131850 - 33131794
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||| |||||||||| || ||||||||||||||||||||    
33131850 ggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgt 33131794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 33801743 - 33801629
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||| | ||||||||    
33801743 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtaaaaaaaaaattgtttttggtccctgcaaatttttttgttt 33801645  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
33801644 ttgaaaatagtccctg 33801629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 34582892 - 34582778
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||  || ||||||||||||||||||||          | ||||||||||| |||| ||||| ||||||||    
34582892 ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggt-cctgtaaaattttttgttt 34582794  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
34582793 ttgaaaatagtccctg 34582778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 218
Target Start/End: Original strand, 543365 - 543474
Alignment:
108 aaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttgg 207  Q
    |||||||| |||| ||| ||||||||||| || |||||||||||||||||||           | |||||||||||||| ||||||| |||||||||||     
543365 aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaat-ttgtttttggtcccagcaaaattttttgtttttga 543463  T
208 aaatagtccct 218  Q
    |||||||||||    
543464 aaatagtccct 543474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 11926038 - 11925983
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||| |||||||||||| |||||||||||| |||||||||  ||||||||||||||    
11926038 aaataggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt 11925983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 214
Target Start/End: Original strand, 14655379 - 14655489
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||  | |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
14655379 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 14655478  T
204 ttggaaatagt 214  Q
    ||| |||||||    
14655479 ttgaaaatagt 14655489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 15116976 - 15116933
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||||||||||||| ||||||||||| |||||||||    
15116976 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtcc 15116933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 192
Target Start/End: Original strand, 19320769 - 19320855
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||| |||||||| ||||||||||||||  ||||||||||| |||||||         |||||||||||||||| ||||||    
19320769 ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgtaagaattttttgttgtttttggtccttgcaaa 19320855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 22822651 - 22822537
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||| ||||||||||||             |||||||||||||||||||||| ||||||||    
22822651 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 22822552  T
204 ttggaaatagtccct 218  Q
    ||  |||||||||||    
22822551 ttaaaaatagtccct 22822537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 24274131 - 24274076
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||||||||||    
24274131 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 24274076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 32885741 - 32885788
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||||||||||||||||||||| ||||||||||| |||||||| ||||    
32885741 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtctctgc 32885788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 156
Target Start/End: Original strand, 494403 - 494457
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||||| |||| ||| ||||||||||| || ||||||||||||||||    
494403 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 494457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 220
Target Start/End: Complemental strand, 494595 - 494545
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    |||| |||||||||||||||||||||||||||||||  ||| |||||||||    
494595 ttgtagtttttggtccctgcaaaatattttgtttttaaaaaaagtccctgc 494545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 1007415 - 1007369
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||||| ||||||||||| ||||| |||||||||    
1007415 ttgttgtttttggtccctgtaaaatattttgcttttgaaaatagtcc 1007369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 5286654 - 5286700
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||||||  |||||||||| ||||||||||||    
5286654 ttgtttttggtccctgcaaaattatttgtttttgaaaatagtccctg 5286700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 6468604 - 6468558
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||  ||||||||||||    
6468604 ttgtttttggtccctgcaaaattttttgttttttaaaatagtccctg 6468558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 117 - 215
Target Start/End: Original strand, 6564595 - 6564692
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||| |||||||||||||| |||||||||||||||||| |         |||||||||||||||||| || ||||||||  ||||| ||||||||    
6564595 ttttggtccctgcaaatatgtctcgttttggttttagtccctat-aattttttttgttgtttttggtccctacagaatattttagttttgaaaatagtc 6564692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 107 - 219
Target Start/End: Complemental strand, 7324189 - 7324079
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtttttg 206  Q
    ||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||          | |||||||||||||||||||||||  ||||||||     
7324189 taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaata--ttgtttttt 7324092  T
207 gaaatagtccctg 219  Q
     ||||||||||||    
7324091 aaaatagtccctg 7324079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 9896344 - 9896390
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||  ||||||||||||    
9896344 ttgtttttggtccctgcaaaattttttgttttttaaaatagtccctg 9896390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 126 - 203
Target Start/End: Complemental strand, 13150728 - 13150651
Alignment:
126 ctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||||| ||||||||||||||||||||         |  |||||||||||||||||||||| ||||||||    
13150728 ctgcaaatatgtctcgttttggttttagtccctgtaaacagaaatatttgtttttggtccctgcaaaattttttgttt 13150651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 158
Target Start/End: Original strand, 13268109 - 13268163
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||||||| ||||||||||| || |||| |||||||||||||    
13268109 ggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct 13268163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 318102 - 318041
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| |||||||||||| ||||  || |||||||||||| | ||||||||||||||||||||    
318102 aaataggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgt 318041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 3414541 - 3414504
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||| |||||||||||||||||||||||||||||    
3414541 ggtccctgtaaaatattttgtttttggaaatagtccct 3414504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 7155865 - 7155906
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||| ||||||||||| |||||||    
7155865 ttgtttttggtccctgcaaaattttttgtttttgaaaatagt 7155906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 12176451 - 12176492
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    |||||||||||||||||||||| ||||||||||| |||||||    
12176451 ttgtttttggtccctgcaaaattttttgtttttgaaaatagt 12176492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 12419776 - 12419821
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||| |||||||||||| ||||||||||| |||||||||||    
12419776 ttgtttttgttccctgcaaaattttttgtttttgaaaatagtccct 12419821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 13268312 - 13268349
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||||||| |||||||||||    
13268312 ggtccctgcaaaatattttgtttttgaaaatagtccct 13268349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 26376042 - 26375989
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
26376042 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 26375989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 31167202 - 31167145
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||||| |||| ||| ||||||||||| || |||||| ||||||||||||    
31167202 ttggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg 31167145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 33808689 - 33808734
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||||| ||||||||||| |||| ||||||    
33808689 ttgtttttggtccctgcaaaattttttgtttttgaaaatggtccct 33808734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #119
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 317812 - 317868
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||  |||| ||| |||||||||||||| ||||||||||||| ||||||    
317812 ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgt 317868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #120
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 777972 - 777928
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    ||||||||||||||| |||||| ||||||||||| ||||||||||    
777972 ttgtttttggtccctacaaaattttttgtttttgaaaatagtccc 777928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 6564943 - 6564888
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| || |||||||| |||||||||||||| ||||||||||||||| ||||    
6564943 ggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtctctgt 6564888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 12612359 - 12612248
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| | || ||| ||||||||||| || ||||| ||||||||||||||          | ||||||||||||| |||||||| ||||||||    
12612359 ggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccttgcaaaattttttgttt 12612260  T
204 ttggaaatagtc 215  Q
    ||  ||||||||    
12612259 tttaaaatagtc 12612248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #123
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 14655903 - 14655959
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||| ||| |||||||| |||||||||| | | ||||||||||||||||||||    
14655903 ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgt 14655959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 159
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||  |||||||| ||||||||||| || |||||||||||||||||||    
20467354 taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg 20467406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 21995064 - 21995120
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||| ||||| || ||||||||||||||||||||    
21995064 ggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgt 21995120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 26375693 - 26375805
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||  || |||||||||||||| |||||||||||| |||||||          |  |||||||| |||||||||||| ||||||||    
26375693 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaaat--tgtttttgttccctgcaaaattttttgttt 26375790  T
204 ttggaaatagtccct 218  Q
    ||  |||||||||||    
26375791 tttaaaatagtccct 26375805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 205
Target Start/End: Complemental strand, 33746960 - 33746928
Alignment:
173 ttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||||    
33746960 ttgtttttggtccctgcaaaatattttgttttt 33746928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 34990025 - 34990069
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||| ||||||||||  ||||||||||    
34990025 ttgtttttggtccctgcaaaattttttgttttttaaaatagtccc 34990069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #129
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    ||||||||||| |||| ||| |||||||||||||| ||||||||||||    
494751 gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 494704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #130
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 777677 - 777790
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||  ||||||||||  || |||||||||||||||||||           | |||||||||||||||||||| | ||||||||    
777677 ggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggtaaaaaaaaat-ttgtttttggtccctgcaaatttttttgttt 777775  T
204 ttggaaatagtccct 218  Q
    ||| ||||| |||||    
777776 ttgaaaatattccct 777790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #131
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 1890452 - 1890397
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||| ||| ||||||||||| || |||||| ||||||||||||    
1890452 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 1890397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #132
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 2373326 - 2373291
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
2373326 ttgtagtttttggtccctgcaaaatattttgttttt 2373291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #133
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 2616068 - 2616033
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
2616068 ttgtagtttttggtccctgcaaaatattttgttttt 2616033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #134
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 151
Target Start/End: Complemental strand, 2616240 - 2616193
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    |||||||||||| |||| ||| ||||||||||| ||||||||||||||    
2616240 ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt 2616193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #135
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 219
Target Start/End: Original strand, 3356210 - 3356253
Alignment:
176 tttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||||||||  ||||||||||| ||||||||||||    
3356210 tttttggtccctgcaaaagtttttgtttttgaaaatagtccctg 3356253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #136
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 107 - 158
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    ||||||||| |||| ||| ||||||||||| || ||||||||||||||||||    
3356495 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 3356444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #137
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 5286756 - 5286791
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
5286756 ttgtagtttttggtccctgcaaaatattttgttttt 5286791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #138
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 6468505 - 6468470
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
6468505 ttgtagtttttggtccctgcaaaatattttgttttt 6468470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #139
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 7155797 - 7155852
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||  |||| ||| ||||||||||| || |||||||||||||||||||    
7155797 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 7155852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #140
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 8680943 - 8680978
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
8680943 ttgtagtttttggtccctgcaaaatattttgttttt 8680978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #141
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 12612191 - 12612156
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
12612191 ttgtagtttttggtccctgcaaaatattttgttttt 12612156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #142
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 117 - 160
Target Start/End: Complemental strand, 13617803 - 13617760
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||| ||||||||||| || ||||||||||||||||||||    
13617803 ttttggtccctgcaaatatgcctcgttttggttttagtccctgt 13617760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #143
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 14428651 - 14428706
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||| |||  |||||||||| || ||||||||||||||||||||    
14428651 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 14428706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #144
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 15076037 - 15076002
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
15076037 ttgtagtttttggtccctgcaaaatattttgttttt 15076002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #145
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 15116839 - 15116874
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
15116839 ttgtagtttttggtccctgcaaaatattttgttttt 15116874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #146
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 19129336 - 19129391
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||| ||||||  ||||||| ||||||||||| || |||||||||||||||||||    
19129336 ggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg 19129391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #147
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 19275874 - 19275839
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
19275874 ttgtagtttttggtccctgcaaaatattttgttttt 19275839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #148
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 20582804 - 20582769
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
20582804 ttgtagtttttggtccctgcaaaatattttgttttt 20582769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #149
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 21995232 - 21995267
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
21995232 ttgtagtttttggtccctgcaaaatattttgttttt 21995267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #150
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 22822423 - 22822458
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
22822423 ttgtagtttttggtccctgcaaaatattttgttttt 22822458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #151
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 151
Target Start/End: Original strand, 23502237 - 23502284
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    |||||||||||| |||||||| ||||||||||| || |||||||||||    
23502237 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 23502284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #152
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 23628799 - 23628854
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||| |||||||| |||||||||| | | ||||||||||||||| ||||    
23628799 gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgt 23628854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #153
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 23770355 - 23770320
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
23770355 ttgtagtttttggtccctgcaaaatattttgttttt 23770320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #154
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 24274005 - 24274040
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
24274005 ttgtagtttttggtccctgcaaaatattttgttttt 24274040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #155
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 117 - 160
Target Start/End: Complemental strand, 31276327 - 31276284
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||| |||||||||||||| |||||| |||||||||||||    
31276327 ttttggtccctgcaaatatgtctcgttttgattttagtccctgt 31276284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #156
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 32885673 - 32885728
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| ||||  || ||||||||||| || |||||||||||||||||||    
32885673 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 32885728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #157
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 32885840 - 32885875
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
32885840 ttgtagtttttggtccctgcaaaatattttgttttt 32885875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #158
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 33131691 - 33131726
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
33131691 ttgtagtttttggtccctgcaaaatattttgttttt 33131726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #159
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 33746891 - 33746926
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
33746891 ttgtagtttttggtccctgcaaaatattttgttttt 33746926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #160
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 218
Target Start/End: Original strand, 33801451 - 33801494
Alignment:
175 gtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||||||||| ||||||||||| |||| ||||||    
33801451 gtttttggtccctgcaaaattttttgtttttgaaaatggtccct 33801494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #161
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 33801576 - 33801541
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
33801576 ttgtagtttttggtccctgcaaaatattttgttttt 33801541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 33808816 - 33808781
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
33808816 ttgtagtttttggtccctgcaaaatattttgttttt 33808781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #163
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Original strand, 1214696 - 1214750
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||  |||||||| |||||||||||||   |||||||||||||||||    
1214696 ggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct 1214750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #164
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 1890232 - 1890262
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
1890232 gtttttggtccctgcaaaatattttgttttt 1890262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #165
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Original strand, 2615872 - 2615926
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||||||| |||| ||| ||||||||||  || ||||||||||||||||||    
2615872 ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct 2615926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #166
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 2616026 - 2615988
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||||||| |||||||||||| ||||||||||||    
2616026 ggtccctgcaaaaaattttgtttttgaaaatagtccctg 2615988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #167
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 204
Target Start/End: Complemental strand, 3356334 - 3356300
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    |||| ||||||||||||||||||||||||||||||    
3356334 ttgtcgtttttggtccctgcaaaatattttgtttt 3356300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #168
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 3356433 - 3356391
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||| ||||| ||||||||||| ||||||||    
3356433 ttgtttttggtccctggaaaattttttgtttttgaaaatagtc 3356391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #169
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 6468463 - 6468425
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||||||  ||||||||||||    
6468463 ggtccctgcaaaatattttgttttttaaaatagtccctg 6468425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #170
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 6591373 - 6591327
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||  ||||||| ||||    
6591373 ttgtttttggtccctgcaaaattttttgttttttaaaatagtgcctg 6591327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #171
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 6851547 - 6851505
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||| | ||||||||||| ||||||||    
6851547 ttgtttttggtccctgcaaatttttttgtttttgaaaatagtc 6851505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #172
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 204
Target Start/End: Original strand, 7155964 - 7155998
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttt 204  Q
    |||| ||||||||||||||||||||||||||||||    
7155964 ttgtagtttttggtccctgcaaaatattttgtttt 7155998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #173
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 11129273 - 11129315
Alignment:
177 ttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||||||| |||||||| ||||||||||| ||||||||||||    
11129273 ttttggtccttgcaaaattttttgtttttgaaaatagtccctg 11129315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #174
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 12176535 - 12176497
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
12176535 ggtccctgcaaaatgttttgtttttgaaaatagtccctg 12176497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #175
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Original strand, 13268182 - 13268224
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| |||||||||||||| ||||||||||| |||||||    
13268182 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 13268224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #176
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Original strand, 15962200 - 15962230
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
15962200 gtttttggtccctgcaaaatattttgttttt 15962230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #177
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 16368791 - 16368761
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
16368791 gtttttggtccctgcaaaatattttgttttt 16368761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #178
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 17321478 - 17321440
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
17321478 ggtccctgcaaaattttttgtttttgaaaatagtccctg 17321440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #179
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 159
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||| |||||||||||||| ||||||||||| |||||||    
19129447 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 19129405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #180
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 155
Target Start/End: Complemental strand, 19275223 - 19275185
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||| |||||||||||||| |||||||||||||||    
19275223 ttttggtccctgcaaatatgtctcgttttggttttagtc 19275185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 21995427 - 21995369
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||| |||  |||||||||| || ||||||| ||||||||||||    
21995427 ttggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgt 21995369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #182
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 22822307 - 22822357
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||| |||| ||||||||||||||  || ||||||||||||||    
22822307 ggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt 22822357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #183
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 30928836 - 30928798
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||| ||||||||||| ||||||||||||    
30928836 ggtccctgcaaaattttttgtttttgaaaatagtccctg 30928798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 103
Target Start/End: Original strand, 33105997 - 33106071
Alignment:
29 ataaattatagtcatttgcataacataactggttgttaaaaaagcttcaattactcttggtcatgaattcaaatt 103  Q
    |||||||| || |||||||||| | |||||| ||   ||||| || ||||||||||| |||||||||||||||||    
33105997 ataaattacagacatttgcatagcttaactgattaccaaaaatgcctcaattactctaggtcatgaattcaaatt 33106071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #185
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 34990143 - 34990113
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
34990143 gtttttggtccctgcaaaatattttgttttt 34990113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #186
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 1890270 - 1890307
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
1890270 ggtccctgcaaaattttttgtttttgaaaatagtccct 1890307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #187
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 159
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||| |||| ||| ||||||||||| ||  ||||||||||||||||||    
5286949 ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 5286896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #188
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 7156006 - 7156043
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
7156006 ggtccctgcaaaattttttgtttttgaaaatagtccct 7156043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #189
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 160
Target Start/End: Original strand, 7323891 - 7323924
Alignment:
127 tgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| ||||||||||||||||||||    
7323891 tgcaaatatgtctcgttttggttttagtccctgt 7323924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #190
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 8680985 - 8681022
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
8680985 ggtccctgcaaaattttttgtttttgaaaatagtccct 8681022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #191
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 151
Target Start/End: Complemental strand, 11129545 - 11129496
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttt 151  Q
    |||||||||||||||||||  || ||||||||||| || |||||||||||    
11129545 ttggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt 11129496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #192
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 11448750 - 11448787
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
11448750 ggtccctgcaaaattttttgtttttgaaaatagtccct 11448787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #193
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 101 - 216
Target Start/End: Complemental strand, 13268463 - 13268354
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||| | |||||||| |||||||||||||      |||||||| |||||||         |||||||||||||||| || |||||| |||     
13268463 attggctaaaataaggttttggtccctgcaaatatgtc------tggttttaatccctgtaaaataaaattgttgtttttggtccatgtaaaataattta 13268370  T
201 tttttggaaatagtcc 216  Q
    |||||| |||||||||    
13268369 tttttgaaaatagtcc 13268354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #194
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 15962321 - 15962276
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    ||||||||||||| |||||||| ||||||||||  |||||||||||    
15962321 ttgtttttggtccgtgcaaaattttttgttttttaaaatagtccct 15962276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #195
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 17321345 - 17321308
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
17321345 ggtccctgcaaaattttttgtttttgaaaatagtccct 17321308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #196
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 17771910 - 17771963
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||| |||| ||| |||||||||||  | ||||||||||||||||    
17771910 tggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc 17771963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #197
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 22792899 - 22792846
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccc 157  Q
    |||||||||||| || | ||| ||||||||||| || |||||||||||||||||    
22792899 ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc 22792846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #198
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 22822465 - 22822502
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccct 218  Q
    |||||||||||||| ||||||||||| |||||||||||    
22822465 ggtccctgcaaaattttttgtttttgaaaatagtccct 22822502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #199
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 206
Target Start/End: Original strand, 25431642 - 25431675
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttg 206  Q
    |||||||||||||||||||||| |||||||||||    
25431642 ttgtttttggtccctgcaaaattttttgtttttg 25431675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #200
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 205
Target Start/End: Original strand, 26375865 - 26375894
Alignment:
176 tttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||||||||||||||||||||||||    
26375865 tttttggtccctgcaaaatattttgttttt 26375894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #201
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 31186592 - 31186535
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| |||| ||  ||||||||||| || ||||| ||||||||||||||    
31186592 tggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgt 31186535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #202
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 34990312 - 34990259
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||    
34990312 taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 34990259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 202
Target Start/End: Original strand, 317976 - 318008
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||| ||||||||||||||||||||||||||||    
317976 ttgtagtttttggtccctgcaaaatattttgtt 318008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 205
Target Start/End: Complemental strand, 2373425 - 2373393
Alignment:
173 ttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||| ||||||||||    
2373425 ttgtttttggtccctgcaaaattttttgttttt 2373393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #205
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 3356142 - 3356194
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||  | ||||||||||||||||    
3356142 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc 3356194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #206
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 154
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||| |||| ||  |||||||||||||| ||||||||||||||    
6591440 ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt 6591392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #207
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 11449169 - 11449113
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| |||  |||||||||| || ||||||||| ||||||||||    
11449169 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgt 11449113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #208
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 12419708 - 12419760
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| ||||  || ||||||||||| || ||||||||||||||||    
12419708 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc 12419760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #209
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 12757936 - 12757888
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    |||||||| |||||||||||| |||||||||||| |  |||||||||||    
12757936 ggctaaaacatgattttggtccctgcaaatatgtatccttttggtttta 12757888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #210
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 205
Target Start/End: Original strand, 14428814 - 14428842
Alignment:
177 ttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||    
14428814 ttttggtccctgcaaaatattttgttttt 14428842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #211
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 19267912 - 19267856
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||||||  ||| |||||||||   |||||||||||||||||||    
19267912 ggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgt 19267856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 27364 - 27250
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         |||||||||||| |||||||||||||||||||||    
27364 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttgatccctgcaaaatattttgttt 27265  T
204 ttggaaatagtccct 218  Q
    ||| | |||||||||    
27264 ttgaacatagtccct 27250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 99 - 216
Target Start/End: Complemental strand, 82711 - 82594
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||         |||||||||||||||| ||||||||||||    
82711 aaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattt 82612  T
199 tgtttttggaaatagtcc 216  Q
    |||||||| |||||||||    
82611 tgtttttgaaaatagtcc 82594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Original strand, 82341 - 82429
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaa 192  Q
    |||||||||||| |||||||| ||||||||| |||| |||||||||||||||||||          |||||||||||||||||||||||    
82341 ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa 82429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 82552 - 82591
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
82552 ggtccctgcaaaatattttgtttttggaaatagtccctgc 82591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 104 - 217
Target Start/End: Complemental strand, 148282 - 148169
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||         ||||| ||||||||||| ||||||||||||||||    
148282 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttttttttggtcccagcaaaatattttgttt 148183  T
204 ttggaaatagtccc 217  Q
    ||| ||||||||||    
148182 ttgaaaatagtccc 148169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 217
Target Start/End: Original strand, 148100 - 148134
Alignment:
183 tccctgcaaaatattttgtttttggaaatagtccc 217  Q
    |||||||||||||||||||||||| ||||||||||    
148100 tccctgcaaaatattttgtttttgaaaatagtccc 148134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 58; Significance: 2e-24; HSPs: 5)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 54815 - 54931
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| |||  |||||||||| || ||||||||||||||||||||         |||||||||||||||||||||||||||| | |||    
54815 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattattttt 54914  T
204 ttggaaatagtccctgc 220  Q
    |||||||||||||||||    
54915 ttggaaatagtccctgc 54931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
50075 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 50023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
55176 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 55124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 49868 - 49829
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
49868 ggtccctgcaaaatattttgtttttggaaatagtccctgc 49829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 54969 - 54930
Alignment:
181 ggtccctgcaaaatattttgtttttggaaatagtccctgc 220  Q
    ||||||||||||||||||||||||||||||||||||||||    
54969 ggtccctgcaaaatattttgtttttggaaatagtccctgc 54930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0472 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: scaffold0472
Description:

Target: scaffold0472; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 7264 - 7151
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |  ||||          | |||||||||||||||| ||||||||||||||    
7264 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttaatttctgtaaaaaaaaaat-ttgtttttggtccctgtaaaatattttgttt 7166  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
7165 ttgaaaatagtccct 7151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: scaffold0535
Description:

Target: scaffold0535; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 9033 - 8913
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||          | ||||||||||||||| |||||| |||    
9033 aaatcggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctacaaaattttt 8934  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||    
8933 tgtttttgaaaatagtccctg 8913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 8734 - 8788
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
8734 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 8788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 8547 - 8662
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||||||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
8547 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 8646  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
8647 ttgaaaatagtccctg 8662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 8715 - 8750
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
8715 ttgtagtttttggtccctgcaaaatattttgttttt 8750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 12182 - 12297
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||| ||||||||||||||          | |||||||||||||||||||||| ||||||||    
12182 ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttgttt 12281  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
12282 ttgaaaatagtccctg 12297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 12537 - 12421
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||||||||| ||| ||||||||||| || |||||||||||||||| |||            ||||||||||||| |||||| | |||||||    
12537 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaatttgtttttggtccatgcaaatttttttgtt 12438  T
203 tttggaaatagtccctg 219  Q
    |||| ||||||||||||    
12437 tttgaaaatagtccctg 12421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811 (Bit Score: 48; Significance: 1e-18; HSPs: 3)
Name: scaffold0811
Description:

Target: scaffold0811; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 1311 - 1425
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
1311 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 1410  T
204 ttggaaatagtccct 218  Q
    ||| |||||||||||    
1411 ttgaaaatagtccct 1425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 1644 - 1533
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    ||||||||||||| ||| ||| ||||||||||| || |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
1644 ggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 1545  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
1544 ttgaaaatagtc 1533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 219
Target Start/End: Complemental strand, 1476 - 1427
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||| |||||||||||||||||||| ||||||||||| ||||||||||||    
1476 ttgtagtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 1427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 217
Target Start/End: Complemental strand, 5708 - 5594
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccct-gtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    |||||||||||| |||| ||| ||||||||||||||||||||||||||||||||| ||            |||||||||||||||||||||| |||||||    
5708 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggtaaaaaaaaaaatttgtttttggtccctgcaaaattttttgtt 5609  T
203 tttggaaatagtccc 217  Q
    |||| ||||||||||    
5608 tttgaaaatagtccc 5594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 5399 - 5450
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtc 155  Q
    |||||||||||| |||| ||| ||||||||||| ||||||||||||||||||    
5399 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 5450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 16722 - 16780
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||    
16722 ttggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgt 16780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 17022 - 16977
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    ||||||||||||||||||||||||||| ||||||||| ||||||||    
17022 ttgttgtttttggtccctgcaaaatatgttgtttttgaaaatagtc 16977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 212
Target Start/End: Complemental strand, 22055 - 21947
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||||||| || ||||| || || |||||||||||||||| |||         |||||||||||| |||||||||||||||||||||    
22055 ggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgtaatttttttttgttgtttttgatccctgcaaaatattttgttt 21956  T
204 ttggaaata 212  Q
    ||| |||||    
21955 ttgaaaata 21947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 158
Target Start/End: Original strand, 21763 - 21804
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||| |||||||||||||| ||||||||||| ||||||    
21763 ttttggtccctgcaaatatgtctcgttttggttttggtccct 21804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 4079 - 3967
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||| | |||||||| |||||||||||||| ||||| ||||||||| || |         |||||||||||||||||||||||||||||| |||    
4079 ggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtctctatgaaaattttttgttgtttttggtccctgcaaaatattttattt 3980  T
204 ttggaaatagtcc 216  Q
    ||| |||| ||||    
3979 ttgaaaatcgtcc 3967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 3747 - 3808
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||| |||||||||||| |||||||| |||||||||||  |||||||||||||| |||||||    
3747 aaataggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgt 3808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 289 - 175
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||||||||             |||||||||||||||||||||| ||||||||    
289 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 191  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
190 ttgaaaatagtccctg 175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 2660 - 2546
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnntt--gttgtttttggtccctgcaaaatattttgt 201  Q
    |||||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |         ||   ||||||||| |||||||||||||  ||||    
2660 ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctataaaaaaatatttgtttgtttttgatccctgcaaaata--ttgt 2563  T
202 ttttggaaatagtccct 218  Q
    |||||||||||||||||    
2562 ttttggaaatagtccct 2546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 2334 - 2382
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 152  Q
    ||||| |||||| |||||||| ||||||||||  |||||||||||||||    
2334 ggctataatatggttttggtccctgcaaatattccttgttttggtttta 2382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 44; Significance: 3e-16; HSPs: 5)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 47925 - 47980
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||    
47925 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 47980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 218
Target Start/End: Complemental strand, 48228 - 48116
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgtt-gtttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||| |||||||| ||||||||||| ||  |||||||||||||| ||||         || || ||||||||||| |||||||||||||||||||    
48228 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaatttttttttttttgtttttggtccttgcaaaatattttgttttt 48129  T
206 ggaaatagtccct 218  Q
    | || ||||||||    
48128 gaaattagtccct 48116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 222817 - 222869
Alignment:
108 aaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||| ||| || ||||||| |||||||||||||||||| |||||    
222817 aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgt 222869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 223172 - 223120
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||||||| ||||||||||||||   ||||||||||||||    
223172 ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc 223120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 158
Target Start/End: Original strand, 222884 - 222925
Alignment:
117 ttttggtctctgcaaatatgtcttgttttggttttagtccct 158  Q
    |||||||| |||||||||||||| ||||||||||| ||||||    
222884 ttttggtccctgcaaatatgtctcgttttggttttggtccct 222925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 15012 - 14903
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||||||  |||||||||||||||||||            |||||||||||||||||||||| ||||||||    
15012 ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaa--attgtttttggtccctgcaaaattttttgttt 14915  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
14914 ttgaaaatagtc 14903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 14697 - 14753
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||    
14697 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 14753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 215
Target Start/End: Complemental strand, 3291 - 3182
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| ||||  || |||||||||||||| ||||||||||||||||||||         |  ||||||||||| |||||||||| ||||||||    
3291 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaat--ttgtttttggtacctgcaaaattttttgttt 3194  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
3193 ttgaaaatagtc 3182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 3125 - 3090
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
3125 ttgtagtttttggtccctgcaaaatattttgttttt 3090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0166
Description:

Target: scaffold0166; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 204
Target Start/End: Original strand, 24372 - 24472
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
24372 ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgttaaaagaaaaatttgtttttggtccctgcaaaattttttgttt 24471  T
204 t 204  Q
    |    
24472 t 24472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 24591 - 24549
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtc 215  Q
    |||||||||||||||||||||| ||||||||||| ||||||||    
24591 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtc 24549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 5209 - 5320
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||| |||||||          | ||||||||||||||| ||||| |||||||||    
5209 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgttt 5308  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
5309 ttgaaaatagtc 5320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 5229 - 5340
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || |||||||||||| |||||||          | ||||||||||||||| ||||| |||||||||    
5229 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgttt 5328  T
204 ttggaaatagtc 215  Q
    ||| ||||||||    
5329 ttgaaaatagtc 5340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 8330 - 8445
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| ||||||||| |||            ||||||||||||| |||||||| ||||||||    
8330 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaaaaaaaaaaaattgtttttggtccttgcaaaattttttgttt 8429  T
204 ttggaaatagtccctg 219  Q
    ||| ||||||||||||    
8430 ttgaaaatagtccctg 8445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 206
Target Start/End: Complemental strand, 8642 - 8540
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||||| |||||| ||||||||| |||         || ||||||||||||| |||||||| ||||||||    
8642 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaattttttttttttgtttttggtccttgcaaaattttttgttt 8543  T
204 ttg 206  Q
    |||    
8542 ttg 8540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 205
Target Start/End: Original strand, 8504 - 8533
Alignment:
176 tttttggtccctgcaaaatattttgttttt 205  Q
    ||||||||||||||||||||||||||||||    
8504 tttttggtccctgcaaaatattttgttttt 8533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 217
Target Start/End: Complemental strand, 366273 - 366164
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
366273 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaattttttgttt 366178  T
204 ttggaaatagtccc 217  Q
    ||  ||||||||||    
366177 tttaaaatagtccc 366164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 366109 - 366074
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
366109 ttgtagtttttggtccctgcaaaatattttgttttt 366074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 365979 - 366035
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||  ||  |||||||||| || ||||||||||||||||||||    
365979 ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgt 366035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 3)
Name: scaffold1001
Description:

Target: scaffold1001; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 2778 - 2887
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| ||||||||||| || ||||||||||||||||||||            |||||||||||||||||||||| ||||||||    
2778 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaattttttgttt 2874  T
204 ttggaaatagtcc 216  Q
    ||  |||||||||    
2875 ttcaaaatagtcc 2887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 3070 - 3024
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||    
3070 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtccctg 3024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 2943 - 2978
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
2943 ttgtagtttttggtccctgcaaaatattttgttttt 2978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 3)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 3918 - 3806
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| |||||||||||  | ||||||||||||||||||||         || ||||||||||||| |||||||| ||||||||    
3918 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt---aacttttttttgtttttggtccttgcaaaattttttgttt 3822  T
204 ttggaaatagtccctg 219  Q
    ||  ||||||||||||    
3821 tttaaaatagtccctg 3806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 3531 - 3584
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
3531 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 3584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 3753 - 3718
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
3753 ttgtagtttttggtccctgcaaaatattttgttttt 3718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 103 - 217
Target Start/End: Complemental strand, 2884 - 2771
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgtt 202  Q
    ||||||||||||| |||||||| |||||||||||||| ||||||  |||||||||| |         |||||||||||||| | |||||||||||||  |    
2884 tggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccctat-aattttttttgttgtttttggtacttgcaaaatattttact 2786  T
203 tttggaaatagtccc 217  Q
    |||| ||||||||||    
2785 tttgaaaatagtccc 2771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0337
Description:

Target: scaffold0337; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 12524 - 12577
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    ||||||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
12524 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 12577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 205
Target Start/End: Original strand, 12593 - 12625
Alignment:
173 ttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||| ||||||||||    
12593 ttgtttttggtccctgcaaaattttttgttttt 12625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 10163 - 10270
Alignment:
99 aaattggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattt 198  Q
    |||| |||||||||||| |||| ||| ||||||||||| ||||||||||||||||||| |||              |||||||||||||||||||| |||    
10163 aaatcggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc-tgtaa------------gtttttggtccctgcaaaattttt 10249  T
199 tgtttttggaaatagtccctg 219  Q
    |||||||| ||||||||||||    
10250 tgtttttgaaaatagtccctg 10270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 10515 - 10459
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||||||||||||| |||||||||||||| |||||    
10515 ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt 10459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 94057 - 94169
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttgttt 203  Q
    |||||||||||| |||| ||| || |||||||| || |||||||||||| |||||||         || |||||||||||||||||||| | ||||||||    
94057 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaaatttttgtttttgtttttggtccctgcaaatttttttgttt 94156  T
204 ttggaaatagtcc 216  Q
    ||  |||||||||    
94157 tttaaaatagtcc 94169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326 (Bit Score: 37; Significance: 0.000000000005; HSPs: 6)
Name: scaffold0326
Description:

Target: scaffold0326; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 4041 - 4093
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
4041 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 4093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 19223 - 19275
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| |||| ||| |||||||||||||| ||||||||||||||||    
19223 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 19275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 4220 - 4177
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||||||||||||| ||||||||||| |||||||||    
4220 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtcc 4177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 19402 - 19359
Alignment:
173 ttgtttttggtccctgcaaaatattttgtttttggaaatagtcc 216  Q
    |||||||||||||||||||||| ||||||||||| |||||||||    
19402 ttgtttttggtccctgcaaaattttttgtttttgaaaatagtcc 19359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 4288 - 4236
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| ||||  || |||||||||||||| ||||||||||||||||    
4288 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc 4236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 19470 - 19418
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtcc 156  Q
    |||||||||||| ||||  || |||||||||||||| ||||||||||||||||    
19470 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc 19418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0578 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0578
Description:

Target: scaffold0578; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 5067 - 5020
Alignment:
107 taaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    ||||||||| ||||||||||||||||||| ||| ||||||||||||||    
5067 taaaatatggttttggtctctgcaaatatatctcgttttggttttagt 5020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 17651 - 17706
Alignment:
105 gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    ||||||||||||||||  || || ||||||||||||||||| ||||||||||||||    
17651 gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgt 17706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 17968 - 17910
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||||| |||| ||| ||||||||||| || |||| ||||| |||||||||    
17968 ttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt 17910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 219
Target Start/End: Complemental strand, 4315 - 4199
Alignment:
101 attggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgtnnnnnnnnnttgttgtttttggtccctgcaaaatattttg 200  Q
    ||||||||||||||| |||| ||| ||||||||||| || |||||||||| ||||| |||         |  |||||||| ||||||||||||| |||||    
4315 attggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaaaaaaaaat--ttgtttttcgtccctgcaaaattttttg 4218  T
201 tttttggaaatagtccctg 219  Q
    |||||  |||||| |||||    
4217 tttttaaaaatagaccctg 4199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 34930 - 34986
Alignment:
103 tggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctg 159  Q
    ||||||||||||| | || ||| ||||||||||| || |||||||||||||||||||    
34930 tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg 34986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 35101 - 35071
Alignment:
175 gtttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||||    
35101 gtttttggtccctgcaaaatattttgttttt 35071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 35204 - 35160
Alignment:
173 ttgtttttggtccctgc-aaaatattttgtttttggaaatagtcc 216  Q
    ||||||||||||||||| |||| |||||||||||| |||||||||    
35204 ttgtttttggtccctgcaaaaaaattttgtttttgaaaatagtcc 35160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 214
Target Start/End: Original strand, 34787 - 34831
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgtttttggaaatagt 214  Q
    ||||||||||||||||||||||||||||||  ||||| |||||||    
34787 ttgttgtttttggtccctgcaaaatattttacttttgaaaatagt 34831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 35084 - 35028
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| ||||| ||  | ||||||||||| ||||||||||||||||||||    
35084 ggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgt 35028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0428 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0428
Description:

Target: scaffold0428; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 7669 - 7704
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
7669 ttgtagtttttggtccctgcaaaatattttgttttt 7704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 17876 - 17841
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
17876 ttgtagtttttggtccctgcaaaatattttgttttt 17841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 18043 - 17987
Alignment:
104 ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagtccctgt 160  Q
    |||||||||||| |||| ||| |||| |||||| || ||||||| ||||||||||||    
18043 ggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgt 17987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0032
Description:

Target: scaffold0032; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 33101 - 33136
Alignment:
170 ttgttgtttttggtccctgcaaaatattttgttttt 205  Q
    |||| |||||||||||||||||||||||||||||||    
33101 ttgtagtttttggtccctgcaaaatattttgttttt 33136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 219
Target Start/End: Complemental strand, 33213 - 33176
Alignment:
182 gtccctgcaaaatattttgtttttggaaatagtccctg 219  Q
    ||||| ||||||||||||||||||| ||||||||||||    
33213 gtccccgcaaaatattttgtttttgaaaatagtccctg 33176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0339 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0339
Description:

Target: scaffold0339; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 3457 - 3405
Alignment:
102 ttggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||||||  |||| ||  |||||||||||||| ||||||||||||||    
3457 ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 3405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 205
Target Start/End: Complemental strand, 11244 - 11216
Alignment:
177 ttttggtccctgcaaaatattttgttttt 205  Q
    |||||||||||||||||||||||||||||    
11244 ttttggtccctgcaaaatattttgttttt 11216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0204 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0204
Description:

Target: scaffold0204; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 154
Target Start/End: Original strand, 17126 - 17174
Alignment:
106 ctaaaatatgattttggtctctgcaaatatgtcttgttttggttttagt 154  Q
    |||||||||| |||||||| || ||||||||| | ||||||||||||||    
17126 ctaaaatatggttttggtccctccaaatatgtttggttttggttttagt 17174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0069 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0069
Description:

Target: scaffold0069; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 103
Target Start/End: Original strand, 2300 - 2328
Alignment:
75 tcaattactcttggtcatgaattcaaatt 103  Q
    |||||||||||||||||||||||||||||    
2300 tcaattactcttggtcatgaattcaaatt 2328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University