View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2154_low_6 (Length: 233)
Name: NF2154_low_6
Description: NF2154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2154_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 5 - 220
Target Start/End: Original strand, 45459105 - 45459320
Alignment:
| Q |
5 |
cacaaggcatatgtggggaggattagtcgtggttgtctcttggtttgtttgagtttctggaacaaattttatgtgtgatgatgtgacgaagtaatgattt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459105 |
cacaaggcatatgtggggaggattagtcgtggttgtctcttggtttgtttgagtttcgggaacaaattttatgtgtgatgatgtgacgaagtaatgattt |
45459204 |
T |
 |
| Q |
105 |
ttgtcgatttcaaacaccctcatctacatgtcaacaactgtttcatcaagaaatttgaccaggagatatttcatgttgttggtcatcattctcaacattc |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459205 |
ttgtcgatttcaaacaccctcatctacttgtcaacaactgtttcatcaagaaatttgaccaggagatatttcatgttgttggtcatcattctcaacattc |
45459304 |
T |
 |
| Q |
205 |
acaacatgcaccagtg |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45459305 |
acaacatgcaccagtg |
45459320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 12499706 - 12499747
Alignment:
| Q |
173 |
tttcatgttgttggtcatcattctcaacattcacaacatgca |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
12499706 |
tttcatgttgtgggtcatcattctcaacattcatgacatgca |
12499747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University