View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21550_high_12 (Length: 300)

Name: NF21550_high_12
Description: NF21550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21550_high_12
NF21550_high_12
[»] chr4 (11 HSPs)
chr4 (4-266)||(31161570-31161832)
chr4 (3-257)||(31150285-31150539)
chr4 (34-144)||(31476882-31476992)
chr4 (78-240)||(31019754-31019916)
chr4 (78-144)||(31029731-31029797)
chr4 (78-144)||(31159299-31159365)
chr4 (78-240)||(31489630-31489792)
chr4 (19-144)||(31528459-31528584)
chr4 (2-74)||(31034102-31034174)
chr4 (28-144)||(31496829-31496945)
chr4 (65-144)||(31502035-31502114)
[»] scaffold1749 (1 HSPs)
scaffold1749 (34-144)||(61-171)
[»] scaffold0428 (1 HSPs)
scaffold0428 (34-144)||(8822-8932)
[»] chr2 (1 HSPs)
chr2 (34-144)||(17438736-17438846)
[»] chr6 (5 HSPs)
chr6 (34-144)||(31560717-31560827)
chr6 (34-144)||(33306548-33306658)
chr6 (34-144)||(31567036-31567146)
chr6 (34-144)||(33412015-33412125)
chr6 (34-144)||(33642510-33642620)


Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 4 - 266
Target Start/End: Complemental strand, 31161832 - 31161570
Alignment:
4 tgggttacaagtctacaagtcttccaaattatttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgt 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31161832 tgggttacaagtctacaagtcttccaaattatttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgt 31161733  T
104 gtgggttgtaggagtttgtgggatgggtggaatagggaagaaagctatcgctactgcattatacaacaaaatctttcatcaatttcctgtgctcttcctt 203  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31161732 gcgggttgtaggagtttgtgggatgggtggaatagggaagaaagctatcgctactgcattatacaacaaaatctttcatcaatttcctgtgctcttcctt 31161633  T
204 attgatgatctaagaaaaatttataggcatgatggtccgatcagtgctcaaaagtaaactcta 266  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31161632 attgatgatctaagaaaaatttataggcatgatggtccgatcagtgctcaaaagtaaactcta 31161570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 3 - 257
Target Start/End: Complemental strand, 31150539 - 31150285
Alignment:
3 ttgggttacaagtctacaagtcttccaaattatttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatg 102  Q
    ||||||||||||| | | | |||||||||  ||||||  |||||| |||||| |  | | |||||||||||||||||||||||||| ||| |||||||||    
31150539 ttgggttacaagttttctaatcttccaaaaaatttagtcgggatgcattctcctctacatgaattagaaaaacatttacttttggactcgcttgatgatg 31150440  T
103 tgtgggttgtaggagtttgtgggatgggtggaatagggaagaaagctatcgctactgcattatacaacaaaatctttcatcaatttcctgtgctcttcct 202  Q
    |  | ||||||||| ||||||||||||||||| ||||||||| | |  | ||||||    ||||||||||||||| |||||||||||||||| ||| |||    
31150439 tccgtgttgtaggaatttgtgggatgggtggagtagggaagacaacccttgctactattctatacaacaaaatctctcatcaatttcctgtgttctgcct 31150340  T
203 tattgatgatctaagaaaaatttataggcatgatggtccgatcagtgctcaaaag 257  Q
    ||||||||||||||| |||||||||||| |||||||||  ||  |||||||||||    
31150339 tattgatgatctaagcaaaatttatagggatgatggtctaattggtgctcaaaag 31150285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 34 - 144
Target Start/End: Original strand, 31476882 - 31476992
Alignment:
34 atttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtgg 133  Q
    |||||| |||||||||||||| || | ||||||||||||| | |||||||||||| || |||||||||||    ||||||||| ||||||||||||||||    
31476882 atttagttgggatggattctcctagacaagaattagaaaagcttttacttttggactctgttgatgatgttcatgttgtaggaatttgtgggatgggtgg 31476981  T
134 aatagggaaga 144  Q
    |||||||||||    
31476982 aatagggaaga 31476992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 78 - 240
Target Start/End: Complemental strand, 31019916 - 31019754
Alignment:
78 ttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtggaatagggaagaaagctatcgctactgcattatacaacaaaatct 177  Q
    ||||||||||| ||||||||||||||  ||||||||||| ||||||||||||||||||||||||||| | || | |||||||| |||||     ||||||    
31019916 ttacttttggactcggttgatgatgttcgggttgtaggaatttgtgggatgggtggaatagggaagacaactctggctactgctttatatggtcaaatct 31019817  T
178 ttcatcaatttcctgtgctcttccttattgatgatctaagaaaaatttataggcatgatggtc 240  Q
     ||||||||||  ||  |  |   |||||||||||||||| ||||| ||||| ||||||||||    
31019816 ctcatcaatttgatgcacgttgttttattgatgatctaagcaaaatatatagacatgatggtc 31019754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 78 - 144
Target Start/End: Complemental strand, 31029797 - 31029731
Alignment:
78 ttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtggaatagggaaga 144  Q
    ||||||||||| ||||||||||||||  ||||||||||| |||||||||||||||||||||||||||    
31029797 ttacttttggactcggttgatgatgttcgggttgtaggaatttgtgggatgggtggaatagggaaga 31029731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 78 - 144
Target Start/End: Complemental strand, 31159365 - 31159299
Alignment:
78 ttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtggaatagggaaga 144  Q
    ||||||||||| || |||||||||||  ||||||||||| |||||||||||||||||||||||||||    
31159365 ttacttttggactccgttgatgatgttcgggttgtaggaatttgtgggatgggtggaatagggaaga 31159299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 78 - 240
Target Start/End: Original strand, 31489630 - 31489792
Alignment:
78 ttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtggaatagggaagaaagctatcgctactgcattatacaacaaaatct 177  Q
    ||||||||||| ||  ||||||||||  ||||||||||| ||||||||||||||||||||||||||| | || | |||||||| |||||     ||||||    
31489630 ttacttttggactccattgatgatgttcgggttgtaggaatttgtgggatgggtggaatagggaagacaactctggctactgctttatatggtcaaatct 31489729  T
178 ttcatcaatttcctgtgctcttccttattgatgatctaagaaaaatttataggcatgatggtc 240  Q
     ||||||||||  ||  |  |   |||||||||||||||| ||||| ||||| ||||||||||    
31489730 ctcatcaatttgatgcacgttgttttattgatgatctaagcaaaatatatagacatgatggtc 31489792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 144
Target Start/End: Complemental strand, 31528584 - 31528459
Alignment:
19 caagtcttccaaattatttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagt 118  Q
    |||| ||||||||| |||||| ||||| | ||||||| | ||||  ||| ||||| | |||||||||||||  ||||||||||||  || |||| ||| |    
31528584 caagccttccaaatgatttagttgggacgcattctctcatagaaagattggaaaagcttttacttttggatgtggttgatgatgttaggattgttggaat 31528485  T
119 ttgtgggatgggtggaatagggaaga 144  Q
    || ||||||||||||| |||||||||    
31528484 ttctgggatgggtggagtagggaaga 31528459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 2 - 74
Target Start/End: Complemental strand, 31034174 - 31034102
Alignment:
2 attgggttacaagtctacaagtcttccaaattatttagctgggatggattctcttacagaagaattagaaaaa 74  Q
    ||||||||||  || | |||||||||||||  |||||| |||||| |||||||||| ||||||||||||||||    
31034174 attgggttaccggttttcaagtcttccaaaagatttagttgggattgattctcttatagaagaattagaaaaa 31034102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 28 - 144
Target Start/End: Original strand, 31496829 - 31496945
Alignment:
28 caaattatttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggat 127  Q
    ||||| |||||| ||||||||| |||| ||   || |||||||||| | |||||||||||| |||||| ||||||   | ||  ||||| ||||||||||    
31496829 caaatgatttagttgggatggactctcatatgcaaaaattagaaaagcttttacttttggactcggttaatgatggtcgtgtcataggaatttgtgggat 31496928  T
128 gggtggaatagggaaga 144  Q
    ||| |||||||||||||    
31496929 gggaggaatagggaaga 31496945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 65 - 144
Target Start/End: Original strand, 31502035 - 31502114
Alignment:
65 attagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtggaatagggaaga 144  Q
    ||||||||||| |||||| ||||| || |||||||||||    | ||||||| | |||||||||||||||||||||||||    
31502035 attagaaaaacttttactcttggactctgttgatgatgttcaagctgtaggaatctgtgggatgggtggaatagggaaga 31502114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1749 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold1749
Description:

Target: scaffold1749; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 34 - 144
Target Start/End: Complemental strand, 171 - 61
Alignment:
34 atttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtgg 133  Q
    |||||| ||||||  |||||| |||||||| |||| || | || ||||||||| |||||||||||| |||  | ||| ||||| |||| |||||||| ||    
171 atttagttgggataaattctcgtacagaagcattaaaacatcagttacttttgaattcggttgatggtgttcgtgttataggaatttgggggatgggagg 72  T
134 aatagggaaga 144  Q
    |||||||||||    
71 aatagggaaga 61  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0428 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0428
Description:

Target: scaffold0428; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 34 - 144
Target Start/End: Complemental strand, 8932 - 8822
Alignment:
34 atttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtgg 133  Q
    |||||| ||||||  |||||| |||||||| |||| || | || ||||||||| |||||||||||| |||  | ||| ||||| |||| |||||||| ||    
8932 atttagttgggataaattctcgtacagaagcattaaaacatcagttacttttgaattcggttgatggtgttcgtgttataggaatttgggggatgggagg 8833  T
134 aatagggaaga 144  Q
    |||||||||||    
8832 aatagggaaga 8822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 34 - 144
Target Start/End: Original strand, 17438736 - 17438846
Alignment:
34 atttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtgg 133  Q
    |||||| ||||||  |||||| || ||||| |||| |||| |||||||||||||| |||||||||| |||  | | | ||||| |||| |||||||| ||    
17438736 atttagttgggataaattctcgtatagaagcattaaaaaatcatttacttttggactcggttgatggtgttcgtgctataggaatttgggggatgggagg 17438835  T
134 aatagggaaga 144  Q
    |||||||||||    
17438836 aatagggaaga 17438846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 34 - 144
Target Start/End: Original strand, 31560717 - 31560827
Alignment:
34 atttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtgg 133  Q
    |||||| ||||||  |||||| || ||||| |||| |||| ||||| |||||||| |||| ||||| |||  | ||| ||||| ||||||| ||||| ||    
31560717 atttagttgggattaattctcctatagaagcattacaaaatcatttgcttttggactcggatgatggtgttcgtgttataggaatttgtggaatgggagg 31560816  T
134 aatagggaaga 144  Q
    |||||||||||    
31560817 aatagggaaga 31560827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 34 - 144
Target Start/End: Complemental strand, 33306658 - 33306548
Alignment:
34 atttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtgg 133  Q
    |||||| |||||| ||||||| || ||||| |||| |||| ||||| |||||||| |||||||||  ||| || | | ||||| ||| ||| ||||| ||    
33306658 atttagttgggattgattctcctatagaagcattaaaaaatcatttgcttttggactcggttgattgtgtttgtgctataggaatttctggaatgggagg 33306559  T
134 aatagggaaga 144  Q
    |||||||||||    
33306558 aatagggaaga 33306548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 34 - 144
Target Start/End: Original strand, 31567036 - 31567146
Alignment:
34 atttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtgg 133  Q
    |||||| |||||| ||||||| || |||||  ||| |||| ||||| |||||||| ||| |||||| |||  | | | ||||| ||||||| ||||| ||    
31567036 atttagttgggattgattctcctatagaagcgttacaaaatcatttgcttttggactcgattgatggtgttcgtgctataggaatttgtggaatgggggg 31567135  T
134 aatagggaaga 144  Q
    |||||||||||    
31567136 aatagggaaga 31567146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 34 - 144
Target Start/End: Complemental strand, 33412125 - 33412015
Alignment:
34 atttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtgg 133  Q
    |||||| ||||||  ||||||  | ||||| |||| |||| |||||||||||||| |||||||||| ||| || | | | ||| ||||||| ||||| ||    
33412125 atttagttgggataaattctcggatagaagtattacaaaatcatttacttttggactcggttgatggtgtttgtgctattggaatttgtggaatgggcgg 33412026  T
134 aatagggaaga 144  Q
    |||||| ||||    
33412025 aataggaaaga 33412015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 34 - 144
Target Start/End: Original strand, 33642510 - 33642620
Alignment:
34 atttagctgggatggattctcttacagaagaattagaaaaacatttacttttggattcggttgatgatgtgtgggttgtaggagtttgtgggatgggtgg 133  Q
    |||||| |||||| ||||||| || | ||| |||| |||| ||||| |||||||| || ||||||| |||  | | | ||||| ||||||| ||||| ||    
33642510 atttagttgggattgattctcctataaaagcattacaaaatcatttgcttttggactcagttgatggtgttcgtgctataggaatttgtggaatgggagg 33642609  T
134 aatagggaaga 144  Q
    |||||||||||    
33642610 aatagggaaga 33642620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University