View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21550_high_15 (Length: 284)
Name: NF21550_high_15
Description: NF21550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21550_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 23529580 - 23529822
Alignment:
| Q |
19 |
tatgggggtatggttgatattttgaatcgnnnnnnnngaaagtgtttccaactttggtatattgagttttaataagtgacttatgtctagtagtgaacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23529580 |
tatgggggtatggttgatattttgaatggaaaaaaaagaaagtgtttccaactttggtatattgagttttaataagtgacttatgtctagtagtgaacaa |
23529679 |
T |
|
| Q |
119 |
aaatataaaacatagaaacatgcaacatcatccatgagtacattatggatttgtcttgatgataattgttttgttgtgtttaatgtagtgccatattggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23529680 |
aaatataaaacatagaaacatgcaacatcatccatgagtacattatggatttgtcttgatgataattgttttgttgtgtttaatgtagtgccatattggt |
23529779 |
T |
|
| Q |
219 |
gggtcatatatgtttgatacatgcatgcattcagcaatttcaa |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23529780 |
gggtcatatatgtttgatacatgcatgcattcagcaatttcaa |
23529822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University