View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21550_low_18 (Length: 283)
Name: NF21550_low_18
Description: NF21550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21550_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 51310207 - 51310452
Alignment:
| Q |
19 |
tggttagtggtttgtgtgcaatggataagcctcgtgaggctgagaatttggttcaggaatttaaacgaacagatggtggtgggaagattcagcttcaacc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310207 |
tggttagtggtttgtgtgcaatggataagcctcgtgaggctgagaatctggttcaggaatttaaacgaacagatggtggtgggaagattcagcttcaacc |
51310306 |
T |
|
| Q |
119 |
ttctgcttttgaattcaagtctattttgtatggatatggaagattgggtttgtttaatgatttgaacagagttgttgatgaaatggagaataatgagttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51310307 |
ttctgcttttgaattcaagtctattttgtatggatatggaatattgggtttgtttaatga-ttgaacagagttgttgatgaaatggagaataatgggttt |
51310405 |
T |
|
| Q |
219 |
gttattgatactgtttgttataatatggttctttcaagttttggaat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310406 |
gttattgatactgtttgttataatatggttctttcaagttttggaat |
51310452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University