View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21550_low_20 (Length: 250)
Name: NF21550_low_20
Description: NF21550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21550_low_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 12164941 - 12165175
Alignment:
| Q |
16 |
atacataagttgcagactgtgtggggtggaaagcatcccagaacacatattgtgctctgtttgcacatggaaattgcattgggagacatgatatttggcc |
115 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12164941 |
atacataagttgcagactgcgttgggtgaaaagcatcccagaacacatattgtgctctgtttgcacatggaaattgcattgggagacatgatatttggcc |
12165040 |
T |
 |
| Q |
116 |
tctattccttccaagaccacaacaagctctatcaataacactgaatgctgcaaccacaacaaaaaatcaccattatgaacacaaatccatcgtattcggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12165041 |
tctattccttccaagaccacaacaagctctatcaataacactgaatgctgcaaccacaacaaaaaatcaccattatgaacacaaatccatcgtcttcggt |
12165140 |
T |
 |
| Q |
216 |
tgaataaacaacttaattaagctcttatagtaaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
12165141 |
tgaataaacaacttaattaagctcttatagcaaaa |
12165175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 215 - 243
Target Start/End: Original strand, 48588564 - 48588592
Alignment:
| Q |
215 |
ttgaataaacaacttaattaagctcttat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48588564 |
ttgaataaacaacttaattaagctcttat |
48588592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University