View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21550_low_23 (Length: 241)
Name: NF21550_low_23
Description: NF21550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21550_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 14334384 - 14334171
Alignment:
| Q |
18 |
ttaactatcttcaaaattgaaagagcactaattgctgttagcttagagtggcagaaactctgccacacctccatcttctgttcctcttccacatccttaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14334384 |
ttaactatcttcaaaattgaaagagcattaattagtgttagcttagagtggcagaaactctgccacacctccatcttctgttcctcttccacatccttaa |
14334285 |
T |
 |
| Q |
118 |
tgattgcctcatacactgaagttgcaatacttcttgctgcatctcttgcctctgggagtctatcattcactaaatcagctgcaacttcaatcaacttttc |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14334284 |
tgattgcctcgtacactgaagttgcaatacttcttgctgcatctcttgcctctgggagtctatcattcactaaatcagctgcaacttcaatcaacttttc |
14334185 |
T |
 |
| Q |
218 |
catcccaaactcct |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
14334184 |
catcccaaactcct |
14334171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University