View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21550_low_7 (Length: 406)
Name: NF21550_low_7
Description: NF21550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21550_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 320; Significance: 1e-180; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 9 - 387
Target Start/End: Complemental strand, 42638519 - 42638143
Alignment:
| Q |
9 |
gaagaatatggtgcgtaatgtgattgaagggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatc |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42638519 |
gaagaatatggtgcgcaatgtgattgaagggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatc |
42638420 |
T |
 |
| Q |
109 |
accacactttttcgtatcattaaaagttatgatatggcagagtacttgaaactggaattcaagaaggtaaatgaatacctggttgctaaatttgtattag |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
42638419 |
accacactttttcgtatcataaaaagttatgatatggcagagtacttgaaactggaattcatgaaggtaaatgaatatctggttgccaaatttgcattag |
42638320 |
T |
 |
| Q |
209 |
ttttctgacgaaagtatgggattgacacaagactttcttcaaattgcaggaaactggatttgctcatatgaggatttgcgacggagttggttcttatctt |
308 |
Q |
| |
|
| || |||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42638319 |
tgttttgacgaaagtatgggact--cacaagactttcttcaaattgcaggaaactggatttgctcatatgaggatttgcgacggagttggttcttatctt |
42638222 |
T |
 |
| Q |
309 |
cagatgtgtggtctgttggctaagtttgctcttgttcgcgaaactgctaaagctgcatgagtaggtcctaagtgcaact |
387 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42638221 |
cagatgtgcggtctgttggctaagtttgctcttgttcgcgacactgctaacgctgcatgagtaggtcctaagtgcaact |
42638143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 9 - 128
Target Start/End: Original strand, 42566433 - 42566552
Alignment:
| Q |
9 |
gaagaatatggtgcgtaatgtgattgaagggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42566433 |
gaagaatatggtgcgtaatgtgattgaagggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatc |
42566532 |
T |
 |
| Q |
109 |
accacactttttcgtatcat |
128 |
Q |
| |
|
|||||| |||||| |||||| |
|
|
| T |
42566533 |
accacaatttttcatatcat |
42566552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 387
Target Start/End: Original strand, 42566560 - 42566608
Alignment:
| Q |
339 |
cttgttcgcgaaactgctaaagctgcatgagtaggtcctaagtgcaact |
387 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42566560 |
cttgttcgcgacactgctaaagctgcatgagtaggtcctaagtgcaact |
42566608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University