View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21550_low_8 (Length: 362)
Name: NF21550_low_8
Description: NF21550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21550_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 33341390 - 33341611
Alignment:
| Q |
1 |
tgttcctgatcttaatattcctcctttgcatcagttcaatgtgtcgtttaataatttaaccgggcaaattccgaagaggttttcgcgtttaaatataagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33341390 |
tgttcctgatcttaatattcctcctttgcatcagttcaatgtgtcgtttaataatttaaccgggcaaattccgaagaggttttcgcgtttaaatataagt |
33341489 |
T |
 |
| Q |
101 |
gctttttctggtaattcgctttgtgggaatcctcttcaagtagcttgtcctggaaacaatgacaaaaatggtttatctggtggagctattgctggtattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33341490 |
gctttttctggtaattcgctttgtgggaatcctcttcaagtagcttgtcctggaaacaatgacaaaaatggtttatctggtggagctattgctggtattg |
33341589 |
T |
 |
| Q |
201 |
tgattggttgtgtttttggttt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33341590 |
tgattggttgtgtttttggttt |
33341611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 219 - 345
Target Start/End: Complemental strand, 33341196 - 33341070
Alignment:
| Q |
219 |
gttttgcaaaatccatgggaattggtcctgttaacgcgttataccggagagaaagtgtctgcaattcagtgagattacctatacctgaaggaaggttacc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33341196 |
gttttgcaaaatccatgggaattggtcctgttaacgcgttataccggagagaaagcgtctgcaattcagtgagattacctatacctgaaggaaggttacc |
33341097 |
T |
 |
| Q |
319 |
ggagagacccatcgccggtaacctcaa |
345 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33341096 |
ggagagacccatcgccggtaacctcaa |
33341070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University