View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21551_low_8 (Length: 371)
Name: NF21551_low_8
Description: NF21551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21551_low_8 |
 | |
|
| [»] scaffold0050 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0050 (Bit Score: 174; Significance: 2e-93; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 36066 - 35885
Alignment:
| Q |
1 |
caacaaccaccccttatggtgccaacaccaataacccctcattgtaaactcaagaagaccccatgaaagacaaaaggttcgaatggccggaaccaagcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36066 |
caacaaccaccccttatggtgccaacaccaataacccctcattgtaaactcaagaagaccccatgaaagacaaaaggttcgaatggcaggaaccaagcaa |
35967 |
T |
|
| Q |
101 |
atctaagaatgagggaaaacacaccacctaagaaatacaaggagagcaatccacactaactcaaagtctacaaagaaccctc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35966 |
atctaagaatgagggaaaacacaccacctaagaaatacaaggagagcaatccacactaactcaaagtctacaaagaagcctc |
35885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 25646954 - 25646778
Alignment:
| Q |
1 |
caacaaccaccccttatggtgccaacaccaataacccctcattgtaaactcaagaagaccccatgaaagacaaaaggttcgaatggccggaaccaagcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||| || ||||||||||||||| ||||||| ||||||| | ||||||| || |
|
|
| T |
25646954 |
caacaaccaccccttatggtgccaacaccaatagccgctcattgtaaactcacgatgaccccatgaaagactaaaggtttgaatggcagaaaccaagaaa |
25646855 |
T |
|
| Q |
101 |
atctaagaatgagggaaaacacaccacctaagaaatacaaggagagcaatccacactaactcaaagtctacaaagaa |
177 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
25646854 |
atctatgattgagggaaaacacaccacctaagaaatacaaggagaacaacccacactaacccaaagtctacaaagaa |
25646778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 14193206 - 14193030
Alignment:
| Q |
1 |
caacaaccaccccttatggtgccaacaccaataacccctcattgtaaactcaagaagaccccatgaaagacaaaaggttcgaatggccggaaccaagcaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| | | |||||||||||||||| ||||||||||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
14193206 |
caacaaccacctcttatggtgccaacaccaatagctgcgcattgtaaactcaagatgaccccatgaaagactaaaggtttgaatggcaggaaccaagcaa |
14193107 |
T |
|
| Q |
101 |
atctaagaatgagggaaaacacaccacctaagaaatacaaggagagcaatccacactaactcaaagtctacaaagaa |
177 |
Q |
| |
|
|| || || |||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
14193106 |
atatatgattgagggaaaacacaccacctaagaaatacaaggagaacaacccacactaacccaaagtctacaaagaa |
14193030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University