View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_high_15 (Length: 597)
Name: NF21553_high_15
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 2e-17; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 223 - 297
Target Start/End: Original strand, 5622067 - 5622141
Alignment:
| Q |
223 |
gccaaatatcacctttagatgagattattaaatttaaagaaaaatgctgttttcgtattttactggatgagagca |
297 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||| || ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5622067 |
gccaaatagcacccttagatgagatcattaaattgaaggaaaaatattgttttcgtattttactggatgagagca |
5622141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 74 - 128
Target Start/End: Original strand, 5621412 - 5621466
Alignment:
| Q |
74 |
ggatgagagagtccactgggtattacataatggtctttatctttctagaagcaca |
128 |
Q |
| |
|
||||||| |||||||||||| | |||| ||||| ||||||||||||||||||||| |
|
|
| T |
5621412 |
ggatgagggagtccactggggaatacagaatggcctttatctttctagaagcaca |
5621466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 466
Target Start/End: Original strand, 31915311 - 31915370
Alignment:
| Q |
411 |
gagttcttcagaggtggaggagg----tgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
31915311 |
gagttcttcagaggtggaggaggagactgatgcatgagggttttattagtaatttagtag |
31915370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 2 - 46
Target Start/End: Original strand, 5621029 - 5621073
Alignment:
| Q |
2 |
tactcttatgggctttccaccatgttaagtgatattcctgctttc |
46 |
Q |
| |
|
||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
5621029 |
tactcttatggactttccaccatgttcagtgctattcctgctttc |
5621073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 409 - 466
Target Start/End: Complemental strand, 13441954 - 13441896
Alignment:
| Q |
409 |
tcgagttcttcagaggtggaggag-gtgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| |||||||| ||||||||| ||||| |
|
|
| T |
13441954 |
tcgaattcttcagaggtggaggagactgatgcagaagggttttgttagtaatttagtag |
13441896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 434 - 466
Target Start/End: Complemental strand, 50857783 - 50857751
Alignment:
| Q |
434 |
tgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
50857783 |
tgatgcaggagggttttattagtaatttagtag |
50857751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 2e-16; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 407 - 466
Target Start/End: Complemental strand, 1217527 - 1217467
Alignment:
| Q |
407 |
ggtcgagttcttcagaggtggaggagg-tgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1217527 |
ggtcgagttcttcaaaggtggaggagactgatgcaggagggttttattagtaattcagtag |
1217467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 409 - 466
Target Start/End: Original strand, 4303181 - 4303239
Alignment:
| Q |
409 |
tcgagttcttcagaggtggaggagg-tgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||| |
|
|
| T |
4303181 |
tcgagttcttcagaggtggaggagactgatgtaggagggttttattagtaatttagtag |
4303239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 407 - 466
Target Start/End: Complemental strand, 13883050 - 13882990
Alignment:
| Q |
407 |
ggtcgagttcttcagaggtggaggagg-tgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||| ||||||||| ||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
13883050 |
ggtcgagttctttagaggtggacgagactgatgcaggagggttttattagtaatttagtag |
13882990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 292 - 335
Target Start/End: Complemental strand, 8915631 - 8915588
Alignment:
| Q |
292 |
agagcaccccaatatatgtaaagccacggttggtatccataact |
335 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
8915631 |
agagcaccccaatatatgtaaagccacaattggtatccttaact |
8915588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 433 - 466
Target Start/End: Original strand, 29175572 - 29175605
Alignment:
| Q |
433 |
gtgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
29175572 |
gtgatgcaggagggttttattagtaatttagtag |
29175605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 407 - 466
Target Start/End: Complemental strand, 365918 - 365858
Alignment:
| Q |
407 |
ggtcgagttcttcagaggtggaggag-gtgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||| |
|
|
| T |
365918 |
ggtcgagttcttcagaggtggaggagattgatgcaggaggattttattagtaatttagtag |
365858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 407 - 466
Target Start/End: Complemental strand, 3064106 - 3064046
Alignment:
| Q |
407 |
ggtcgagttcttcagaggtggaggag-gtgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3064106 |
ggtcgagttcttcagaggtggaggagactgatgcaggagggttttgttagtaatttagtag |
3064046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 225 - 297
Target Start/End: Complemental strand, 21423512 - 21423440
Alignment:
| Q |
225 |
caaatatcacctttagatgagattattaaatttaaagaaaaatgctgttttcgtattttactggatgagagca |
297 |
Q |
| |
|
|||||| |||| |||||||| || |||||||| || ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
21423512 |
caaatagcacccttagatgatatcattaaattgaaggaaaaatatcggtttcgtattttactggatgagagca |
21423440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 21424520 - 21424476
Alignment:
| Q |
1 |
atactcttatgggctttccaccatgttaagtgatattcctgcttt |
45 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
21424520 |
atactcttatggactttccaccatgttcagtgctattcctgcttt |
21424476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 82 - 127
Target Start/End: Complemental strand, 21424191 - 21424146
Alignment:
| Q |
82 |
gagtccactgggtattacataatggtctttatctttctagaagcac |
127 |
Q |
| |
|
|||||||||||| | |||| ||||| |||||||||||||||||||| |
|
|
| T |
21424191 |
gagtccactggggaatacagaatggcctttatctttctagaagcac |
21424146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 433 - 466
Target Start/End: Original strand, 53012777 - 53012810
Alignment:
| Q |
433 |
gtgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
53012777 |
gtgatgcaggagggttttattagtaatttagtag |
53012810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 434 - 466
Target Start/End: Complemental strand, 43304297 - 43304265
Alignment:
| Q |
434 |
tgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
43304297 |
tgatgcaggagggttttattagtaatttagtag |
43304265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 434 - 466
Target Start/End: Complemental strand, 43307011 - 43306979
Alignment:
| Q |
434 |
tgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
43307011 |
tgatgcaggagggttttattagtaatttagtag |
43306979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 409 - 466
Target Start/End: Original strand, 31636059 - 31636117
Alignment:
| Q |
409 |
tcgagttcttcagaggtggaggagg-tgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||| |
|
|
| T |
31636059 |
tcgagttcttcagaggtggaggagactgatgtaggagggttttattagtaatttagtag |
31636117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 407 - 460
Target Start/End: Original strand, 35681976 - 35682030
Alignment:
| Q |
407 |
ggtcgagttcttcagaggtggaggag-gtgatgcaggagggttttattagtaatt |
460 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
35681976 |
ggtcgagttcttcagaggtggaggagactgatgcaggagggttttcttagtaatt |
35682030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 407 - 466
Target Start/End: Complemental strand, 27952692 - 27952632
Alignment:
| Q |
407 |
ggtcgagttcttcagaggtggaggag-gtgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
27952692 |
ggtcgagttcttcagaggtggaggagactgatgtaggagggttttattaataatttagtag |
27952632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 407 - 452
Target Start/End: Original strand, 22011154 - 22011200
Alignment:
| Q |
407 |
ggtcgagttcttcagaggtggaggag-gtgatgcaggagggttttat |
452 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
22011154 |
ggtcgagttctttagaggtggaggagagtgatgcaggagggttttat |
22011200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.00000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 407 - 466
Target Start/End: Complemental strand, 22512415 - 22512355
Alignment:
| Q |
407 |
ggtcgagttcttcagaggtggaggagg-tgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
22512415 |
ggtcgagttctttagaggtggaggagactgatgcaggagagttttattagtaatttagtag |
22512355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 407 - 460
Target Start/End: Original strand, 26377794 - 26377848
Alignment:
| Q |
407 |
ggtcgagttcttcagaggtggaggag-gtgatgcaggagggttttattagtaatt |
460 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
26377794 |
ggtcgagttcttcaaaggtggaggagactgatgtaggagggttttcttagtaatt |
26377848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 433 - 466
Target Start/End: Original strand, 24730820 - 24730853
Alignment:
| Q |
433 |
gtgatgcaggagggttttattagtaattcagtag |
466 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
24730820 |
gtgatgcaggagggttttattagtaatttagtag |
24730853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 225 - 297
Target Start/End: Complemental strand, 30634726 - 30634654
Alignment:
| Q |
225 |
caaatatcacctttagatgagattattaaatttaaagaaaaatgctgttttcgtattttactggatgagagca |
297 |
Q |
| |
|
|||||| |||| |||||||| || |||||||| || ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
30634726 |
caaatagcacccttagatgatatcattaaattgaaggaaaaatatcggtttcgtattttactggatgagagca |
30634654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 30635719 - 30635675
Alignment:
| Q |
1 |
atactcttatgggctttccaccatgttaagtgatattcctgcttt |
45 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
30635719 |
atactcttatggactttccaccatgttcagtgctattcctgcttt |
30635675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 82 - 127
Target Start/End: Complemental strand, 30635390 - 30635345
Alignment:
| Q |
82 |
gagtccactgggtattacataatggtctttatctttctagaagcac |
127 |
Q |
| |
|
|||||||||||| | |||| ||||| |||||||||||||||||||| |
|
|
| T |
30635390 |
gagtccactggggaatacagaatggcctttatctttctagaagcac |
30635345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University