View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_high_98 (Length: 229)
Name: NF21553_high_98
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_high_98 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 212
Target Start/End: Original strand, 4865824 - 4866023
Alignment:
| Q |
13 |
aagaagaaaaatcaggtttccatgccattttcactcagcacggtcgtgcgcatcttttgtctggttgtgcgtccctgattggtgtggttgtgcgcaggaa |
112 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4865824 |
aagaagaaaaatcaagtttccatgccattttcactcagcacggtcgtgcgcatcttttgtctggtcgtgcgtccctgattggtgtggttgtgcgcaggaa |
4865923 |
T |
|
| Q |
113 |
caatgagtgacatgcacggaccctgcgccttacctgcacgatcgtgcgtcccttcataggctcatttttggacgttttgaacaataagttggaagcaagt |
212 |
Q |
| |
|
||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4865924 |
caacgattgacatgcacggaccctgcgccttacccgcacgatcgtgcgtcccttcataggctcatttttggacgttttgaacaataagttggaagcaagt |
4866023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University