View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_100 (Length: 236)
Name: NF21553_low_100
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_100 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 51804541 - 51804740
Alignment:
| Q |
17 |
cacagatacaccggccacccatatagtgttcatcttcttactcttgtaaccatccgaacataatggaaagtttctttgatcagatgaattagcattaacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804541 |
cacagatacaccggccacccatatagtgttcatcttcttactcttgtaaccatgtgaacataatggaaagtttctttgatcagatgaattagcattaacc |
51804640 |
T |
|
| Q |
117 |
ggcatcatcacacataaaccaggattccctgcaaagctttcaactaaccctcctttaatcaatttaggaggaataggaccagaaagaagattgtgtgaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804641 |
ggcatcatcacacataaaccaggattccctgcaaagctttcaactaaccctcctttaatcaatttaggaggaataggaccagaaagaagattgtgtgaaa |
51804740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University