View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_101 (Length: 235)
Name: NF21553_low_101
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_101 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 15 - 235
Target Start/End: Original strand, 7306235 - 7306455
Alignment:
| Q |
15 |
atttacagctacgactcgctatttttaattaaacagaaaactcaactgaatgatttggttgtatagaggagaggatagaaaatttattaagccgacttga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7306235 |
atttacagctacgactcgctatttttaattaaacagaaaactcaactgaatgatttggttgtatagaggagaggatagaaaatttattaagccgacttga |
7306334 |
T |
|
| Q |
115 |
ctatatgatattattttctttctaaactgtttgatgcattgattgacgccaaataacaaaaattgcattaaaaagtgtactatttaaaatcacctcataa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7306335 |
ctatatgatattattttctttctaaactgtttgatgcattgattgacgccaaataacaaaaattgcattaaaaagtgtactatttaaaatcacctcataa |
7306434 |
T |
|
| Q |
215 |
atctcgggttcttttatacgc |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7306435 |
atctcgggttcttttatacgc |
7306455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University