View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_103 (Length: 226)
Name: NF21553_low_103
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_103 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 15 - 211
Target Start/End: Complemental strand, 45644143 - 45643937
Alignment:
| Q |
15 |
agattctttaagcagggttttggatttgaactttgtgggtgnnnnnnntgtggtgaggactcatagaaggaaaaactcctctaaaggtggcaatcctggc |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45644143 |
agattctttaagcaaggttttggatttgaactttgtgggtgaaaaaaatgtggtgaggactcttagaaggaaaaactcctctaaaggtggcaatcctggc |
45644044 |
T |
 |
| Q |
115 |
gaactttaagtgccccctcataaatttaaaaggcaaccacgatattagaaactttctagttttgag----------cttcaataaggttttaaaatagga |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45644043 |
gaactttaagggccccctcataaatttaaaaggcaaccacgatattagaaactttctagttttgagcttctttgagcttcaataaggttttaaaatagga |
45643944 |
T |
 |
| Q |
205 |
acctatg |
211 |
Q |
| |
|
||||||| |
|
|
| T |
45643943 |
acctatg |
45643937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University